Skip to main content

Table 1 List of genes and RT-PCR primers used

From: Y-27632 enhances differentiation of blastocyst like cystic human embryoid bodies to endocrinologically active trophoblast cells on a biomimetic platform

Gene Sequence Annealing Temperature (°C) Product Size(bp)
Oct 4 CGACCATCTGCCGCTTTGAG
CCCCCTGTCCCCCATTCCTA
57 572
Nanog CCTCCTCCATGGATCTGCTTATTCA
CAGGTCTTCACCTGTTTGTAG
57 262
GAPDH GGGCGCCTGGTCACCAGGGCTG
GGGGCCATCCACAGTCTTCTG
60 531
βIIITubulin CTTGGGGCCCTGGGCCTCCGA
GGCTTCCTGCAGTGGTACACGGGCG
60 174
GATA4 TCCAAACCAGAAAACGGAAG
CTGTGCCCGTAGTGAGATGA
60 187
Brachury ACCCAGTTCATAGCGGTGAC
ATGAGGATTTGCAGGTGGAC
60 216
BMP2 TGTATCGCAGGCACTCAGGTCAG
AAGTCTGGTCACGGGGAAT
60 328
GATA2 TGACTTCTCCTGCATGCACT
AGCCGGCACCTGTTGTGCAA
60 244
HAND1 TGCCTCAGAAAGAGAACCAG
ATGGCAGGATGAACAAACAC
60 274
BMP4 GTCCTGCTAGGAGGCGCGAG
GTTCTCCAGATGTTCTTTCG
60 339
βhCG GCTACTGCCCCACCATGACC
ATGGACTCGAAGCGCACATC
55 95
GCM1 CGGAAACGCTGTCCCAACT
CCCTTCAGGCTCAATGAGACG
57 235
IGF2 CAATGGGGAAGTCGATGCTG
CTTGGCGAGCACGTGAC
61 421
FGFR1 GGACTCTCCCATCACTCTGCAT
CCCCTGTGCAATAGATGATGATC
56 109