Skip to main content

Table 1 Primers sequence utilized in the semiquantitative RT-PCR

From: Combinatorial gene therapy renders increased survival in cirrhotic rats

Gene Primers
HPRT S 5' TCCCAGCGTCGTGATTAGTG 3'
A 3' GGCTTTTCCACTTTCGCTGA 5'
HGF S 5' ATGCTCATGGACCCTGGT 3'
A 3' GCCTGGCAAGCTTCATTA 5'
c-met S 5' CAGTGATGATCTCAATGGGCAAT 3'
A 3' AATGCCCTCTTCCTATGACTTC 5'
TGF-β1 S 5' GCCTCCGCATCCCACCTTTG 3'
A 3' GCGGGTGACTTCTTTGGCGT 5'