Skip to main content

Advertisement

Table 1 Sequence information on the primers used for real-time PCR

From: Overexpression of Insig-1 protects β cell against glucolipotoxicity via SREBP-1c

Gene name Sequences for forward and reverse primers (5'-3') Gene Bank accession number
SREBP-1c GGAGCCATGGATTGCACATT L16995
  AGGCCAGGGAAGTCACTGTCT  
IRS-2 CCACACGCCTTTCGCTAGA XM-573948
  GTACCCCCTTCACCAAAGTCAA  
UCP-2 GCATTGGCCTCTACGACTCT NM-019354.2
  CTGGAAGCGGACCTTTACC  
PDX-1 AAACGCCACACACAAGGAGAA NM-022852
  AGACCTGGCGGTTCACATG  
GLUT-2 CAGCTGTCTCTGTGCTGCTTGT NM-012879
  GCCGTCATGCTCACATAACTCA  
Insulin TCTTCTACACACCCATGTCCC NM-019130
  GGTGCAGCACTGATCCAC  
FAS GCTGCTGCTGTGGACCTCAT X62888
  TTTATACTGGTCGGCGGCTC  
GAPDH TGGTGGACCTCATGGCCTAC XM-344448
  CAGCAACTGAGGGCCTCTCT