Skip to main content

Table 1 Primers used for qRT-PCR

From: MicroRNA-1 induces apoptosis by targeting prothymosin alpha in nasopharyngeal carcinoma cells

Name Symbol Entrez Gene ID Sequences (5' to 3')
C5-QF C5 NM_001735 CGGTGCTGGAGTTTAATGTCAA
C5-QR C5 NM_001735 TGGCTGAGAGATGAGTATGCTATTG
CARD8-QF CARD8 NM_001184900 TTTCTCAGGTGCAGCCTTTG
CARD8-QR CARD8 NM_001184900 CTCCACCAGCTCCTTCTCAT
FAIM-QF FAIM NM_018147 ACAGCGGGTGAGTTTGTAGA
FAIM-QR FAIM NM_018147 CTTCCCACTACTGACAGCCT
GRIN2A-QF GRIN2A NM_001134408 GACAAGGATCCGACGTCTACCT
GRIN2A-QR GRIN2A NM_001134408 GCATGACCGTGGCTTGCT
PTMA-QF PTMA NM_002823 CGAAATCACCACCAAGGACTT
PTMA-QR PTMA NM_002823 GTCAGCCTCCTGCTCCC
TP63-QF TP63 NM_001114982 GCAGTTGTGTTGGAGGGATGA
TP63-QR TP63 NM_001114982 CCCATCTCTGGTTTCCAGAGTAAC
GAPDH-QF GAPDH NM_002046 GCACCGTCAAGGCTGAGAA
GAPDH-QR GAPDH NM_002046 AGGGATCTCGCTCCTGGAA