Skip to main content

Table 2 Oligonucleotides used for pmirGLO luciferase reporter vector construction

From: MicroRNA-1 induces apoptosis by targeting prothymosin alpha in nasopharyngeal carcinoma cells

Name Sequences(5' to 3')
PTMA#1-wt-se ACGAGCTCTTGTATTTTTTATTTACATTTTATCTAGAG
PTMA#1-wt-as CTCTAGATAAAATGTAAATAAAAAATACAAGAGCTCGT
PTMA#1-mut-se ACGAGCTCTTGTATTTTTTATTATGTAATTATCTAGAG
PTMA#1-mut-as CTCTAGATAATTACATAATAAAAAATACAAGAGCTCGT
PTMA#2-wt-se ACGAGCTCAAACAATCTTATTCCGAGCATTCCATCTAGAG
PTMA#2-wt-as CTCTAGATGGAATGCTCGGAATAAGATTGTTTGAGCTCGT
PTMA#2-mut-se ACGAGCTCAAACAATCTTATTCCGAGGTAAGGATCTAGAG
PTMA#2-mut-as CTCTAGATCCTTACCTCGGAATAAGATTGTTTGAGCTCGT
pmirGLO-sequencing-primer TGAAGAGCCTGATCAAATAC