Skip to main content

Table 1 Human and mouse primers used for real-time PCR

From: Tumour necrosis factor alpha downregulates human hemojuvelin expression via a novel response element within its promoter

  Primer Forward (5′-----------3′) Reverse (5′-----------3′)
human hepcidin CTGCAACCCCAGGACAGAG GGAATAAATAAGGAAGGGAGG
human HJV GGAGCTTGGCCTCTACTGGA ATGGTGAGCTTCCGGGTG
human GAPDH TGGTATCGTGGAAGGACTC AGTAGAGGCAGGGATGATG
mouse hepcidin1 CCTATCTCCATCAACAGATG AACAGATACCACACTGGGAA
mouse Hjv TGCCAGAAGGCTGTGTAAGG TCTAAATCCGTCAAGAAGACTCG
mouse TNF-a CCAGACCCTCACACTCAGATCA CACTTGGTGGTTTGCTACGAC
mouse IL-6 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC
mouse BMP-2 TGGAAGTGGCCCATTTAGAG TGACGCTTTTCTCGTTTGTG
mouse BMP-4 ACGTAGTCCCAAGCATCACC TCAGTTCAGTGGGGACACAA
mouse BMP-6 ATGGCAGGACTGGATCATTGC CCATCACAGTAGTTGGCAGCG
mouse TGF- β CACCGGAGAGCCCTGGATA TGTACAGCTGCCGCACACA
mouse β-actin GACGGCCAAGTCATCACTATT CCACAGGATTCCATACCCAAGA