Skip to main content


Table 1 List of primers used in the present study to amplify genes

From: HLA class II SNP interactions and the association with type 1 diabetes mellitus in Bengali speaking patients of Eastern India

Designation Chromosome location Sequence Annealing temperature Product size(bp)
HLA-DPA1* 6p21.3 (Exon2) F-5’ GCGGACCATGTGTGTCAACTTAT 3’ 55°C 210
HLA-DPB1* 6p21.3 (Exon2) F-5’ GAGAGTGGCGCCTCCGCTCAT 3’ 63°C 327
HLA-DQA1 6p21.3$ (Exon1) F-5’ CAAACTCTTCAGCTAGTAAC 3’ 58°C 262
6p21.3* (Exon2) F-5’ ATGGTGTAAACTTGTACCAGT 3’ 55°C 229
  6p21.3$ (Exon3) F-5’ AGGTTCCTGAGGTCACAGTGTTT 3’ 54°C 328
HLA-DQB1* 6p21.3(Exon2) F-5’ CATGTGCTACTTCACCAACGG 3’ 58°C 211
HLA-DRB1* 6p21.3(Exon2) F-5’ CCCCACAGCACGTTTCTTG 3’ 60°C 274
  1. *(Tanaka et al. 1999), $(Cordovado et al. 2005).