Skip to main content

Table 1 Primer sequences used for quantitative real-time RT-PCR

From: Role of SALL4 in the progression and metastasis of colorectal cancer

  Forward primer sequence Reverse primer sequence
SALL4 CCAAAGGCAACTTAAAGGTTCAC CCGTGAAGACCAATGAGATCTC
GAPDH GGAAGGTGAAGGTCGGAGTCA GTCATTGATGGCAACAATATCCACT