Skip to main content

Table 1 Nucleotide sequences of primers used for real time PCR detection

From: Dioscin promotes osteoblastic proliferation and differentiation via Lrp5 and ER pathway in mouse and human osteoblast-like cell lines

Gene Primer sequence (5’ to 3’)
Lrp5 Forward: ctgccaggatcgctctgatg
Reverse: acactgttgcttgatgaggacacac
β-catenin Forward: gccacaggattacaagaagc
Reverse: ccaccagagtgaaaagaacg
OPG Forward: ttacctggagatcgaattctgcttg
Reverse: gtgctttcgatgaagtctcagctg
RANKL Forward: gcagcatcgctctgttcctgta
Reverse: cctgcaggagtcaggtagtgtgtc
GAPDH Forward: gaccacagtccatgccatcac
Reverse: gctgttgaagtcgcaggagac