Skip to main content

Table 1 Primers used for the amplification of the P1 region

From: Study of Coxsackie B viruses interactions with Coxsackie Adenovirus receptor and Decay-Accelerating Factor using Human CaCo-2 cell line

Region Primer Orientation Sequence (5’-3’)a Positionb Reference
VP1 292 Sense MIGCIGYIGARACNGG 2613–2628 30
222 Antisense CICCIGGIGGIAYRWACAT 2969–2951
VP2 AM12 Sense GARGARTGYGGITAYAGYGA 962–981 31
AM32 Antisense TTDATCCAYTGRTGIGG 1545–1529
VP3 RC7 Sense GTVHDIAAYGCIGGHATGGG 1463-1482 This study
RC8 Antisense GTYTGCATIGTGTCDSHIGG 2597-2578
VP4 RC1 Sense CCATATAGYTATTGGATTGGC 615-635 This study
RC2M Antisense GGIARYTTCCACCACCAHCC 1197-1178
VP1-2A RC5M Sense TIACITTTGTSATHACIAG 2799-2817 This study
RC6 Antisense ACIACRCCYTCICCICCCAT 3690-3671
  RC10 Antisense TCCCACACRCAVYTYWGCC 3396-3378 This study
  RC5-B2 Sense CTAACWTTYGTCATNACCAG 2813-2832 This study
  RC5-B4 Sense CTYACMTTTGTSATYACYAG 2802-2821 This study
  RC5-B3 Sense CTGACGTTTGTCATAACAAG 2798-2817 This study
  RC5(B5/B6) Sense GARYTVACYTTTGTSATHAC 2801-2820 This study
  RC11(B2,B4,B5,B6) Antisense TCYCTRTTRTARTCYTCCC 3417-3399 This study
  RC12(B3) Antisense TCYCTGTTGTAACTTTCCC 3411-3393 This study
  1. a The following standard ambiguity codes were used: D = G, A, or T; R = A or G; Y = T or C; N = A, T, C, or G; M = A or C; S = G or C; H = A, C or T; W = A or T and I = deoxyinosine.
  2. b With reference to the sequence of CV-B3.