Study of Coxsackie B viruses interactions with Coxsackie Adenovirus receptor and Decay-Accelerating Factor using Human CaCo-2 cell line

Table 1 Primers used for the amplification of the P1 region

Region	Primer	Orientation	Sequence (5’-3’)^a	Position^b	Reference
VP1	292	Sense	MIGCIGYIGARACNGG	2613–2628	30
VP1	222	Antisense	CICCIGGIGGIAYRWACAT	2969–2951	30
VP2	AM12	Sense	GARGARTGYGGITAYAGYGA	962–981	31
VP2	AM32	Antisense	TTDATCCAYTGRTGIGG	1545–1529	31
VP3	RC7	Sense	GTVHDIAAYGCIGGHATGGG	1463-1482	This study
VP3	RC8	Antisense	GTYTGCATIGTGTCDSHIGG	2597-2578	This study
VP4	RC1	Sense	CCATATAGYTATTGGATTGGC	615-635	This study
VP4	RC2M	Antisense	GGIARYTTCCACCACCAHCC	1197-1178	This study
VP1-2A	RC5M	Sense	TIACITTTGTSATHACIAG	2799-2817	This study
VP1-2A	RC6	Antisense	ACIACRCCYTCICCICCCAT	3690-3671	This study
	RC10	Antisense	TCCCACACRCAVYTYWGCC	3396-3378	This study
	RC5-B2	Sense	CTAACWTTYGTCATNACCAG	2813-2832	This study
	RC5-B4	Sense	CTYACMTTTGTSATYACYAG	2802-2821	This study
	RC5-B3	Sense	CTGACGTTTGTCATAACAAG	2798-2817	This study
	RC5(B5/B6)	Sense	GARYTVACYTTTGTSATHAC	2801-2820	This study
	RC11(B2,B4,B5,B6)	Antisense	TCYCTRTTRTARTCYTCCC	3417-3399	This study
	RC12(B3)	Antisense	TCYCTGTTGTAACTTTCCC	3411-3393	This study

a The following standard ambiguity codes were used: D = G, A, or T; R = A or G; Y = T or C; N = A, T, C, or G; M = A or C; S = G or C; H = A, C or T; W = A or T and I = deoxyinosine.
b With reference to the sequence of CV-B3.

ISSN: 1423-0127