Skip to main content

Table 1 Primers used for real time quantitative PCR to detect gene expression in H9c2 cells

From: Molecular identification for epigallocatechin-3-gallate-mediated antioxidant intervention on the H2O2-induced oxidative stress in H9c2 rat cardiomyoblasts

Accession no. mRNA name Primer sequence (5’ → 3’) Size of products (bp)
NM_032416.1 Aldehyde dehydrogenase 2 family (mitochondrial) (Aldh2) Forward: TGGCTGATCTCATCGAACGG (360–379) 134
Reverse: CCAGCCAGCATAATAGCGGA (493–474)
NM_012554.3 Enolase 1, (alpha) (Eno1) Forward: CCTACTGCCAGAACTTCACCA (102–122) 208
Reverse: GAGACACCCTTCCCCATGAA (309–290)
NM_057141.1 Heterogeneous nuclear ribonucleoprotein K (Hnrnpk) Forward: CACCTTGCTTTGTGGTCACTG (1700–1720) 232
Reverse: TTAGTTTAGGGGTGGGCTGG (1931–1912)
NM_001007149.1 Staufen, RNA binding protein, homolog 2 (Drosophila) (Stau2) Forward: CAGAGCGGGGTCATTTCTCG (25–44) 220
Reverse: GGATGCTATGGAAACGGGCT (244–225)
NM_022521.3 Ornithine aminotransferase (Oat) Forward: CAGGGTGAAGCGGGTGTTAT (803–822) 262
Reverse: CGTGCTCGCCTGGTTTAATG (1064–1045)
NM_053917.1 Inositol polyphosphate-4-phosphatase, type II (Inpp4b) Forward: ATGGAAAAGATGCCGCCTGA (2739–2758) 239
Reverse: TCGTCTCTCAGGATGGAGCA (2977–2958)
NM_053512.2 Peroxiredoxin 4 (Prdx4) Forward: GCCAAGATTTCCAAGCCAGC (268–287) 284
Reverse: CTTATTGGCCCCAGTCCTCC (551–532)
NM_130428.1 Succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (Sdha) Forward: ATGGGCGAACCTACTTCAGC (793–812) 84
   Reverse: AAGGTAAACCAGCCCGAGTG (876–857)