Skip to main content

Table 1 List of primer pairs used for RT-PCR/ qPCR

From: Fibroblast Growth Factor-2 alone as an efficient inducer for differentiation of human bone marrow mesenchymal stem cells into dopaminergic neurons

Gene Primer sequence Annealing temp.
Nestin GCCCTGACCACTCCAGTTTA 55.0°C
GGAGTCCTGGATTTCCTTCC
Neurofilament TGGGAAATGGCTCGTCATTT 56.7°C
CTTCATGGAAGCGGCCACTT
TUJ I GGGATCCACTCCACGAAGTA 61.0°C
CGAGACCTACTGCATCGACA
MAP2 CTCAACAGTTCTATCTCTTCTTCA 60.0°C
TCTTCTTGTTTAAATCCTAACACT
TH (For RT & qPCR) GGTCGCGCTGCCTGTACT 53.9°C
TCATCACCTGGTCACCAAGTT
GAPDH GACAAGCTTCCCGTTCTCAG 57.0°C
GAGTCAACGGATTTGGTCGTCGT