Skip to main content

Table 1 Primers used in the present study

From: AIRE acetylation and deacetylation: effect on protein stability and transactivation activity

Construct Oligonucleotidesequence (5'-3')
AIRE Lys102Gln Fprimer: CTGGACAGCTTCCCCCAAGATGTGGACCTCAGCCA
Rprimer: TGGCTGAGGTCCACATCTTGGGGGAAGCTGTCCAG
AIRE Lys102Arg Fprimer: CTGGACAGCTTCCCCAGAGATGTGGACCTCAGCCA
Rprimer: TGGCTGAGGTCCACATCTCTGGGGAAGCTGTCCAG
AIRE Lys111Gln F-primer: CTCAGCCAGCCCCGGCAGGGGAGGAAGCCCCCG
R-primer: CGGGGGCTTCCTCCCCTGCCGGGGCTGGCTGAG
AIRE Lys111Arg F-primer: CTCAGCCAGCCCCGGAGGGGGAGGAAGCCCCCG
R-primer: CGGGGGCTTCCTCCCCCTCCGGGGCTGGCTGAG
AIRE Lys131-133Gln F-primer: CTCCCCACCCAGAGGCAGGCCTCAGAAGAGGCT
R-primer: AGCCTCTTCTGAGGCCTGCCTCTGGGTGGGGAG
AIRE Lys131-133Arg F-primer: CTCCCCACCAGGAGGAGGGCCTCAGAAGAGGCT
R-primer: AGCCTCTTCTGAGGCCCTCCTCCTGGTGGGGAG
  1. Abbreviations: F-primer Forward primer, R-primer Reverse primer.