Skip to main content

Table 1 Primers used in luciferase reporter plasmid construction

From: Flavonoid ingredients of Ginkgo biloba leaf extract regulate lipid metabolism through Sp1-mediated carnitine palmitoyltranferase 1A up-regulation

Primer namea Sequence(5’-to-3’)
pCPT1A-1/Luc_F GGGGTACCTTTCTTGTAGCTATGGTAGGC
pCPT1A-2/Luc_F GGGGTACCGAAGAGCCCTGGGAACAGAC
pCPT1A-1 ~ 2/Luc_R CCCAAGCTTCCCCTGATGGTATTCACCCCT
pCPT1A-3/Luc_F GGGGTACCTTTCTTGTAGCTATGGTAGGC
pCPT1A-4/Luc_F GGGGTACCTAAGGCCTCCCCAGTGCGG
pCPT1A-5/Luc_F GGGGTACCGTCCCTGCCCCGCCCGGC
pCPT1A-6/Luc_F GGGGTACCGGAAGGGCGCACGGT
pCPT1A-3 ~ 6/Luc_R CCCAAGCTTGTCTGTTCCCAGGGCTCTTC
  1. a_R: reverse primer, _F: forward primer.