Skip to main content


Table 1 Primer sequences employed in the analyses of HLPt -mRNA expression and respective amplicon sizes

From: Effects of human blood red cells on the haemolytic capability of clinical isolates of Candida tropicalis

Gene Orientation Sequence (5′ → 3′) Amplicon size Reference
Β-Actin FW AACCTCTTCTCAATCATCTGC 129 pb Vandeputte et al. [25]
  1. *HLPt primers were designed based on the complete ORF of the putative C. tropicalis haemolysin-like protein gene sequence using Gene Runner 3.05 software.