Skip to main content

Table 1 Sequences of the primers used to detect β-lactamases genes

From: Multidrug-resistant phenotype and isolation of a Novel SHV- beta-Lactamase variant in a clinical isolate of Enterobacter cloacae

PCR target Primer name Primer sequence 5′ → 3′ Annealing T° Ampliquons size
CTX-M CTX-M-A CGCTTTGCGATGTGCAG 54 539
CTX-M-B ACCGCGATATCGTTGGT
SHV SHV-1 F ATGCGTTATATTCGCCTGTGTAT 54 868
SHV-1R TTAGCGTTGCCAGTGCTCGATCAG
TEM TEM-A2 GTATCCGCTCATGAGACAAT 54 932
TEM-ext GTATATATGAGTAAACTTGGTCTG
OXA OXA-1 F CACAATACATATCAACTTCGC 54 793
OXA-1R GTGTGTTTAGAATGGTGATCGC