Skip to main content

Advertisement

Table 1 Primer sequences for cloning and mutagenesis of the constructs

From: N-terminal functional domain of Gasdermin A3 regulates mitochondrial homeostasis via mitochondrial targeting

Construct name Method Primer sequences (5’ → 3’)
Gsdma3 PCR cloning forward, AGCGTCGACAGACAATGCCTGTGTTTGAGG;
-pENTR2B reverse, CCGGAATTCGAAGATAGAGCACAATAAGTAAGTGC
Gsdma3I359N -pENTR2B mutagenesis forward, GCTAACTGAAGAACAACTGAAGAATCTAGTAA AATCCTTGGAGA
reverse, TCTCCAAGGATTTTACTAGATTCTTCAGTTGTTCTTCAGTTAGC
Gsdma3M1Btlr mutagenesis forward, GCTAACTGAAGAACAACTGAAGAATCTAGTAA AATCCTTGGAGA;
-pENTR2B
reverse, TCTCCAAGGATTTTACTAGA TTCTTCAGTTGTTCTTCAGTTAGC
Gsdma3M1Btlr PCR cloning forward, AGCGTCGACAGACAATGCCTGTGTTTGAGG;
-pENTR2B
reverse, GCGGA ATTCCCCTCCAAGGATTTTACTAG
N-Gsdma3 PCR cloning forward, AGCGAATTCAGACAATGCCTGTGTTTGAGG;
-pCDNA3.1-myc-His(-)A reverse, AGCGAATTCCGCTGTCATTGCAAATGTACGG
C-Gsdma3 PCR cloning forward, AGCGAATTCATATGCAAACCTTCCCTAAGATCAGG;
-pCDNA3.1-myc-His(-)A reverse, CCGGAATTCCAAGATAGAGCACATAAGTAAGTGC
C-Gsdma3Rim3 PCR cloning forward, AGCGAATTCATATGCAAACCTTCCCTAAGATCAGG;
-pCDNA3.1-myc-His(-)A reverse, CCGGAATTCCAAGATAGAGCACATAAGTAAGTGC
Gsdma3 PCR cloning forward, TCCGCGGCCGCACCATGCCTGTGTTTGAGGAT;
-pIRES-hrGFP-1a
reverse, CCGGAATTCCAGATAGAGCACAATAAGTAA
Gsdma3Rim3 PCR cloning forward, TCCGCGGCCGCACCATGCCTGTGTTTGAGGAT;
-pIRES-hrGFP-1a
reverse, CCGGAATTCCAGATAGAGCACAATAAGTAA
N-Gsdma3 PCR cloning forward, TCCGCGGCCGCACCATGCCTGTGTTTGAGGAT;
-pIRES-hrGFP-1a
reverse, CCGGAATTCCGCTGTCATTGCAAATGTACGG
C-Gsdma3 PCR cloning forward, TCCGCGGCCGCACGATGCAAACCTTCCCTAAG;
-pIRES-hrGFP-1a
reverse, CCGGAATTCCAGATAGAGCACAATAAGTAA
C-Gsdma3 (no tag) PCR cloning forward, AGCGAATTCATATGCAAACCTTCCCTAAGATCAGG;
-pCDNA3.1-myc-His(-)A reverse, CCGGAATTCAAAGATAGAGCACATAAGTAAGTGC
C-Gsdma3Rim3 (notag) PCR cloning forward, AGCGAATTCATATGCAAACCTTCCCTAAGATCAGG;
-pCDNA3.1-myc-His(-)A reverse, CCGGAATTCAAAGATAGAGCACATAAGTAAGTGC