Skip to main content

Table 1 The used primers in this study

From: The prognostic effect of PTEN expression status in colorectal cancer development and evaluation of factors affecting it: miR-21 and promoter methylation

Amplified factor primers 5′ to 3′ Product size (bp) AT (°C) Genbank accession number
miR-21 S TGTCGGGTAGCTTATCAGAC ~90 55 NR_029493
  AS Adapter primer in kit    
U6-snRNA S GCTTCGGCAGCACATATAC ~120 55 NR_004394
  AS Adapter primer in kit    
PTEN S ACCAGAGACAAAAAGGGAGTA 173 56 NM_000314
  AS ACCACAAACTGAGGATTGCA    
HPRT S TGGACTAATTATGGACAGGACT 219 56 NM_000194
  AS CCTGTTGACTGGTCATTACAAT    
PTEN Promoter      
 Unmethylated (−300)a S-U TGGGTTTTGGAGGTTGTTGGT 173 55 NG_007466.2
AS-U ACTTAACTCTAAACCACAACCA    
 Methylated (−298)a S-M GGTTTCGGAGGTCGTCGGC 155 57  
AS-M CAACCGAATAATAACTACTACGACG    
  1. S sense, AS antisense, U unmethylated, M methylated, AT annealing temperature
  2. aDistance of the 5′ nucleotide of the sense primer from the transcription start site of PTEN gene