Skip to main content

Table 1 Primer pairs used for quantitative real-time PCR

From: Integrated miRNA and mRNA expression profiling in fetal hippocampus with Down syndrome

Name Sequence (5′- 3′)
MiRNA Universal Primer GTGCAGGGTCCGAGGT
hsa-miR-138-5p-RT GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACcggcct
hsa-miR-138-5p-AS GCATAGCTGGTGTTGTGAATCAG
hsa-miR-409-5p-RT GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACatgcaa
hsa-miR-409-5p-AS TCAGGTTACCCGAGCAACTTT
hsa-miR-19-3p-RT GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACtcagtt
hsa-miR-19-3p-AS GCTGTGCAAATCCATTCAA
hsa-miR-204-5p-RT GTCGTATCCAGTGCAGGGTCCGAGG
TATTCGCACTGGATACGACaggcat
hsa-miR-204-5p-AS GCTTCCCTTTGTCATCCT
U6 Fw CTCGCTTCGGCAGCACA
U6 Re AACGCTTCACGAATTTGCGT
MAML1 Fw TCCTCACTTGCTGCAGTGTC
MAML1 Re CTCCCCTGACTCCCGAAAAC
NNAT Fw GGCCGTATCATCAGGTGCTC
NNAT Re TCTACTGGCCCCTCACTGAC
SOX11 Fw TAGCCACTCCAGGTTTGGGA
SOX11 Re CTGTTTCACAGCAATAGGCCG
EZH2 Fw CCATCCAGACTGGCGAAGAG
EZH2 Re AGGCAGCTGTTTCAGAGGAG
VEZF1 Fw GCCTCAACTGACAGAGGAGAAG
VEZF1 Re TCCAAAGTACTCCTTGGCTCC
ITGB3BP Fw ACCAACTTCTGCATCTGCCT
ITGB3BP Re TAGACATGCACCTGCCAACT
CBX2 Fw CAAGTGCCGTCACTGGGAA
CBX2 Re CGTCAGAAGTGCCAGATACCTA
EFNB1 Fw TGTGCACTTTGACCCCAGTT
EFNB1 Re GTGGAGGTGGATGGTGTGAG
SMARCC1 Fw CTGGAATACGGGAACCGAGG
SMARCC1 Re TTGTCAAAAGGCACTGGGGT
PCP4 Fw ATGAGTGAGCGACAAGGTG
PCP4 Re TTCAGGTGGACTAGGAGGG
C2CD2 Fw GAAGACTCCCATCAAGGTG
C2CD2 Re GATCCCTGATATGATAATAGTGC
APP Fw CCGACCGAGGACTGACCACT
APP Re TGACAACACCGCCCACCAT
MX1 Fw GGTCAGTTACCAGGACTACGA
MX1 Re GTTATGCCAGGAAGGTCTATT
PDXK Fw TTGTGCAGGAGCTGAAGCA
PDXK Re GGTTGGGCGTGATAATGTCT
AGPAT3 Fw TCTACGGGAAGAAGTACGAGG
AGPAT3 Re GACAGGAAGTTCAGGAGGGT
GAPDH Fw CATGTACGTTGCTATCCAGGC
GAPDH Re CTCCTTAATGTCACGCACGAT
  1. RT Reverse transcript primer, AS anti-sense primer, Fw forward primer, Re reverse primer