Skip to main content

Table 1 Primer sequences for RT-qPCR

From: MicroRNA-365 alleviates morphine analgesic tolerance via the inactivation of the ERK/CREB signaling pathway by negatively targeting β-arrestin2

Primer Forward (5′-3′) Reverse (5′-3′)
miR-365 CGTAATGCCCCTAAAAAT GTGCAGGGTCCGAGGT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
β-arrestin2 CCAGGGTCTTCAAGAAGTC TTGCCCAAGTACACGGT
ERK CTCTGTCATTGCCACCA ATCCACTCTCCATCTCCAT
CREB TACCCAGGGAGGAGCAATACA GGTGCTGTGCGAATCTGGTAT
GAPDH CCGAGGGCCCACTAAAGG TGCTGTTGAAGTCACAGGAGACA
  1. RT-qPCR Reverse transcription quantitative polymerase chain reaction, ERK Extracellular signal-regulated kinase, CREB cAMP-response element binding protein, GAPDH Glyceraldehyde-3-phosphate dehydrogenase