Skip to main content

Table 1 Primers used in this study

From: STAT3 exacerbates survival of cancer stem-like tumorspheres in EGFR-positive colorectal cancers: RNAseq analysis and therapeutic screening

Gene Direction Sequence (5′ to 3′)
LGR5 Forward CTCTTCCTCAAACCGTCTGC
Reverse GATCGGAGGCTAAGCAACTG
CD133 Forward CTATTCAGGATATACTCTCAGCATT
Reverse TTTCTGTGGATGTAACTTTCAGTG
PDGFA Forward ACGTCAGGAAGAAGCCAAAA
Reverse GGCTCATCCTCACCTCACAT
GAPDH Forward GAGTCAACGGATTTGGTCGT
Reverse TTGATTTTGGAGGGATCTCG