Skip to main content

Table 1 Primers specific for rat inducible nitric oxide synthase (iNOS), and tumor necrosis alpha (TNF-α) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), forward and reverse. F: Forward primer sequence. R: Reverse primer sequence

From: Effects of glucosamine against morphine-induced antinociceptive tolerance and dependence in mice

1 F(iNOS, Rattus) GGGTCTTGTTAGCCTAGTCA
2 R(iNOS, Rattus) TGTTGTTGGGCTGGGAATAG
3 F(TNFα, Rattus) CCCAACAAGGAGGAGAAGTT
4 R(TNFα, Rattus) GGCTTGTCACTCGAGTTTTG
5 F(GAPDH, Rattus) AGCTCATTTCCTGGTATGACA
6 R (GAPDH, Rattus) TTGCTCTCAGTATCCTTGCT