Skip to main content

Table 1 Sequences of primers used in this study

From: TREM-1-dependent M1 macrophage polarization restores intestinal epithelium damaged by DSS-induced colitis by activating IL-22-producing innate lymphoid cells

Gene 5′ to 3′ end Sequence
GAPDH F GCATCCACTGGTGCTGCC
R TCATCATACTTGGCAGGTTTC
TREM-1 F GTCTCAGAAGTCAAAGCTGC
R GTCTGGTAGTCTCTGCCAAG
TNFα F CCTCACACTCAGATCATCTTC
R CGGCTGGCACCACTAGTTG
IL-6 F GCCTTCCCTACTTCACAAGT
R GAATTGCCATTGCACAACTCT
IFNγ F CTTCCTCATGGCTGTTTCTG
R TGTCACCATCCTTTTGCCAG
IL-1β F TTGAAGAAGAGCCCATCCTC
R CAGCTCATATGGGTCCGAC
IL-17a F GCTTCATCTGTGTCTCTGATG
R GCGCCAAGGGAGTTAAAGAC
IL-22 F TCCGAGGAGTCAGTGCTAA
R AGAACGTCTTCCAGGGTGAA
IL-23a F GCCTGGAACGCACATGCAC
R CCTTTGCAAGCAGAACTGGC
GMCSF F GAACCTCCTGGATGACATGC
R CAGTCCGTTTCCGGAGTTG
iNOS F CATTCTACTACTACCAGATCG
R GCAAAGAACACCACTTTACC
IL-12a F ACATGGTGAAGACGGCCAG
R GAAGTCTCTCTAGTAGCCAG
Arg-1 F GGGTGGAGACCACAGTCTG
R AGTGTTGATGTCAGTGTGAGC
YM-1 F TTATCCTGAGTGACCCTTCTAAG
R TCATTACCCTGATAGGCATAGG
IL-10 F ATGCAGGACTTTAAGGGTTAC
R CCTGAGGGTCTTCAGCTTC