Skip to main content

Advertisement

Table 1 The primer sequences, annealing temperature and fragment sizes for molecular analysis

From: Analysis of polymorphisms, promoter methylation, and mRNA expression profile of maternal and placental P53 and P21 genes in preeclamptic and normotensive pregnant women

 MethodPrimer Sequence 5′ ➔ 3’PCR Product (bp)Tm °C
 P21-rs1059234PCR-RFLPaForward: CCCAGGGAAGGGTGTCCTG
Reverse: GGGCGGCCAGGGTATGTAC
29864
 P21-rs1801270PCR-RFLPForward: GTCAGAACCGGCTGGGGATG
Reverse: CTCCTCCCAACTCATCCCGG
27264
 TP53-rs1042522PCR-RFLPForward: GTCCCAAGCAATGGATGAT
Reverse: CAAAAGCCAAGGAATACACG
55161
 P21
promoter region
MSPbFM: TACGCGAGGTTTCGGGATC
RM: CCCTAATATACAACCGCCCCG
17460
FU: GGATTGGTTGGTTTGTTGGAATTT
RU: ACAACCCTAATATACAACCACCCCA
164
 P53
promoter region
MSPFM: GTAGTTTGAACGTTTTTATTTTGGC
RM: CCTACTACGCCCTCTACAAACG
11560
FU: GTAGTTTGAATGTTTTTATTTTGGT
RU: CCTACTACACCCTCTACAAACA
115
 P21Real-time PCRForward: GCTCTGCTGCAGGGGACAGC
Reverse: TCTGCCGCCGTTTTCGACCC
13660
 P53Real-time PCRForward: GAGCTGAATGAGGCCTTGGA
Reverse: CTGAGTCAGGCCCTTCTGTCTT
15160
 β-ActinReal-time PCRForward: CCTGGCACCCAGCACAAT
Reverse: GCCGATCCACACGGAGTACT
7060
  1. a Polymerase chain reaction–restriction fragment length polymorphism b Methylation Specific PCR