Skip to main content

Table 1 The primer sequences for constructing FKBP10 domain deletion mutants

From: FKBP10 promotes proliferation of glioma cells via activating AKT-CREB-PCNA axis

FKBP10 mutants Forward Reverse
∆1 (aa1–150) AACAAGGAAGACACCGTGCAGGTGAGCACAT CATAGAATTCGAAGCTTGAGCTCGAGATC
∆2 (aa174–262) AACCCGAAGGACGCTGTCCAGCTAGAGAC GTCCTGGACCATGCGGGGGCAGTG
∆3 (aa286–374) AACCCTGCGGATGTGGTGGAAATCAGGACAC CCCGGCCCCGGCTCTGCGGACA
∆4 (aa399–486) GATGGGCTGCCCACAGGCTACCTGTTTG AAGCTTGGTGGTCTCATTGCAGGTCTCAGATGG
∆5 (497–582) GGATCCACCGGATCTAGATAACTGATCATAAT CACAAACAGGTAGCCTGTGGGCAGCCC