Skip to main content

Table 1 Primer pairs used in this study

From: “Point of no return” in unilateral renal ischemia reperfusion injury in mice

Gene Sequence
18 sForward
Reverse
5′GCAATTATTCCCCATGAA3′
3′AGGGCCTCACTAAACCAT5′
ClusterinForward
Reverse
5′AAAAGCCGTGCGGAATGAGA3′
3′TCGCAAGGCGGCTTTTATTG5′
Col1a1Forward
Reverse
5′ ACATGTTCAGCTTTGTGGACC3′
3′TAGGCCATTGTGTATGCAGC5′
Ccl2Forward
Reverse
5′ CCTGCTGTTCACAGTTGCC3′
3′ATTGGGATCATCTTGCTGGT5′
Il-6Forward
Reverse
5′ CGGCCTTCCCTACTTCAC3′
3′GCCATTGCACAACTCTTTTCTCA5′
Kim-1Forward
Reverse
5′ TCAGCTCGGGAATGCACAA3′
3′TGGTTGCCTTCCGTGTCTCT5′
Laminin (Lamb2)Forward
Reverse
5′ CATGTGCTGCCTAAGGATGA3′
3′TCAGCTTGTAGGAGATGCCA5′
NgalForward
Reverse
5′ ATGTCACCTCCATCCTGGTCAG3′
3′GCCACTTGCACATTGTAGCTCTG5′
Tgf-ß1Forward
Reverse
5′ GGAGAGCCCTGGATACCAAC3′
3′CAACCCAGGTCCTTCCTAAA5′
Tnf-αForward
Reverse
5′ AGGGTCTGGGCCATAGAACT3′
3′ CCACCACGCTCTTCTGTCTA5′
  1. 18 s 18 s ribosomal RNA, Col1a1 Collagen, type I, α 1, Ccl-2 chemokine (C-C motif) ligand 2, Il-6 Interleukin 6, Kim-1 Kidney injury molecule 1, Ngal Neutrophil gelatinase-associated lipocalin, Tgf-β1 Transforming growth factor β 1, Tnf-α Tumor necrosis factor-α