Skip to main content

Table 1 Primers and plasmids used in this study

From: Bacterial factors required for Streptococcus pneumoniae coinfection with influenza A virus

Primer name Sequence (5’ to 3’) Purpose
ribA-flank-F GTATCATATGCGATACAC ΔribA
ribA-flank-R GAGCTGGCTATCATGATG
ribA-inverse-F TGACTGATTATCCTTTCTGC ΔribA (iPCR)
ribA-inverse-R ATGAACACTTATGAAGGTAATTTAG
zmpA-flank-FF CTCAGAAAAAGGAAAAAATC ΔzmpA
zmpA-flank-FR TCCTAATAGTAAACATATTCCTCCTTGAAA
zmpA-flank-RF TTTCAAGGAGGAATATGTTTACTATTAGGA
zmpA-flank-RR CACGACTGAGAGATAATTCTAA
zmpA-inverse-F TATTCCTCCTTGAAATAAAATTTATATATG ΔzmpA (iPCR)
zmpA-inverse-R TGTTTACTATTAGGAAATAAAG
Putative aminotransferase-flank-F TGACACCGCTTCATTTTTCA ΔPA
Putative aminotransferase-flank-R CTTTCCTTGTTGACCCACAG
Putative aminotransferase-inverse-F CTTTGTCTTATCCTTCTAAG ΔPA (iPCR)
Putative aminotransferase-inverse-R AAATCCAGCCTTCTAGGAG
prtA-flank-FF GAAGGAACCACGACACTGC ΔprtA
prtA-flank-FR TCTATAGCTTTTGTCTTTAATTCCTTACAT
prtA-flank-RF ATGTAAGGAATTAAAGACAAAAGCTATAGA
prtA-flank-RR CATCAACTGAGCCAGAATATTTG
prtA-inverse-F TTTAATTCCTTACATATTTATTTAAAC Δ prtA (iPCR)
prtA-inverse-R GACAAAAGCTATAGAAAAAAATG
Psepc-F_EcoRIa CTGAATTCGAAGATCGATTTTCGTTCGTG Promoter region sequence of spectinomycin
Pspec-R_PLP-F_OL ATCATATTTTCCCATTATTTTGATTAGTACC
PA-F_Pspec-R_OL GGTACTAATCAAAATAATGGGAAAATATGAT Putative aminotransferase gene
PA-R_CAT-F_OL TTCAATCTATATCACTTAACGTTTGGCAAA
CAT-F_PLP-R_OL TTTGCCAAACGTTAAGTGATATAGATTGA Chloramphenicol
CAT-R_EcoRIa GTGAATTCTTATTTATTCAGCAAGTC
12133-F TTGCAAGATAAGATTATCCAG ΔPA::PA
12136-R TTAAACGGATATTCTTTAGAG
Plasmid Features Reference
pDL278 specr; E. coli-Streptococcous shuttle vector [47]
pJET1.2/blunt Cloning vector Thermo Fisher
  1. aBoldface letter indicates EcoRI cutting site