Skip to main content

Table 1 Primers list

From: HBx facilitates ferroptosis in acute liver failure via EZH2 mediated SLC7A11 suppression

Primer Sequence 5′–3′
GPX4 sense GTAACCAGTTCGGGAAGCAG
GPX4 anti-sense TGTCGATGAGGAACTGTGGA
SLC11A2 sense TGCGGAAGCTAGAAGCATTT
SLC11A2 anti-sense CATGTTGTGTGGCATGATGA
SLC7A11 sense TTGTTTTGCACCCTTTGACA
SLC7A11 anti-sense AAAGCTGGGATGAACAGTGG
ACSL4 sense CCGACCTAAGGGAGTGATGA
ACSL4 anti-sense CCTGCAGCCATAGGTAAAGC