Skip to main content

Advertisement

Table 1 Q-PCR primers.

From: PKCα mediated induction of miR-101 in human hepatoma HepG2 cells

Name Forward primer Reverse primer
hsa-miR-101 CGGCGGTACAGTACTGTGATAA Universal stem-loop primer*
hsa-miR-29c CGGCGGTAGCACCATTTGAAAT  
hsa-miR-122 CGGCGGTGGAGTGTGACAATGG  
hsa-miR-16 CGGCGGTAGCAGCACGTAAATA  
B2M AGGACTGGTCTTTCTATCTCT TTCATCCAATCCAAATGCGG
  1. * The universal stem-loop primer: CTGGTGTCGTGGAGTCGGCAATTC