Skip to main content

Table 1 Primers used and their sequences

From: A role of ygfZ in the Escherichia coli response to plumbagin challenge

Name Sequence (5' to 3') Used in construction
PygfZF CCATGGCTTTTACACCTTTTCCTCCCCG pQE-ygfZ
PygfZR AGATCTCTCTTCGAGCGAATACGGCAGC  
PsodAF GGACTTATGAGCTATACCCTGCCATC pQE-sodA
PsodAR GGATCCTTTTTTCGCCGCAAAACGTA  
PkpygfZF CCATGGGTATGGCTTTTACACCTTTTCC pQE-Kp_ygfZ
PkpygfZR AGATCTATTTTCTTCCAGCGAATACGGC  
PRv0811cF CCATGGCCGCAGTCCCTGCCCCAGACCC pQE-Rv_0811c
PRv0811cR AGATCTCCGAATACCGCCGCGCAGCCGC  
PygfZK226AF CAGCTTTAAGGCCGGCTGTTATACCG pQE-ygfZK226A
PygfZk226AR CGGTATAACAGCCGGCCTTAAAGCTG  
PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC pQE-ygfZG227A
PygfZG227AR GTCCGGTATAACAGGCTTTCTTAAAG  
PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG pQE-ygfZC228A
PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAG  
PygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC pQE-ygfZC228S
PygfZC228SR GTCCGGTATACGAGCCTTTCTTAAAG  
PygfZC228MF CTTTAAGAAAGGCATGTATACCGGAC pQE-ygfZC228M
PygfZC228MR GTCCGGTATACATGCCTTTCTTAAAG  
PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG pQE-ygfZY229A
PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA  
PygfZT230AF AAGGCTGTTATGCCGGACAAGAGATG pQE-ygfZT230A
PygfZT230AR CATCTCTTGTCCGGCATAACAGCCTT  
PygfZG231AF GCTGTTATACCGCGCAAGAGATGGTG pQE-ygfZG231A
PygfZG231AR CACCATCTCTTGCGCGGTATAACAGC  
PygfZQ232AF CTGTTATACCGGAGCAGAGATGGTGG pQE-ygfZQ232A
PygfZQ232AR CCACCATCTCTGCTCCGGTATAACAG  
PygfZE233AF GTTATACCGGACAGGCCATGGTGGCGCGA pQE-ygfZE233A
PygfZE233AR TCGCGCCACCATGGCCTGTCCGGTATAAC  
PygfZΔ226-237F GGGCGGTATCAGCTTTAAGGCCAAATTCC pQE-ygfZΔ226-237
PygfZΔ226-237R GGAATTTGGCCTTAAAGCTGATACCGCCC  
PQEF GGCGTATCACGAGGCCCTTTTCG Fragment amplification
PQER CATTACTGGATCTATCAACAGG Fragment amplification