Skip to main content

Table 2 PCR primers and conditions used determine imprinted gene expression and DNA methylation

From: Expression of KCNQ1OT1, CDKN1C, H19, and PLAGL1 and the methylation patterns at the KvDMR1 and H19/IGF2 imprinting control regions is conserved between human and bovine

Gene/ICR Symbol Primers (5′-3′) PCR Annealiang Tm (°C) PCR size (bp) Primer [] μM MgCI2(9mM) #Cycles
H19 Forward GATATGGTCCGGTGTGATGGAGAGAGCA 62.8 752 0.3 2.5 35
Reverse TTCGGAGCCTCCAGACTGCGGTG
KCNQ1OT1 Forward TCGAGGGTACCGGATTCCCAGGC 64 502 0.3 2.5 35
Reverse CGCAGGACACCCCAACTACAGCC
CDKN1C Forward GGAGGCGCCGCGATCAAGAAG 62 745 0.3 4 35
Reverse GACAGCGAAAGCGCGAAGAGAC
PLAGL1 Forward TCAACCGGAAAGACCACCTGAAGA 60 834 0.3 4 35
Reverse GGTCAAAGCCTGCATTGAGCTTGT
H19/IGF2ICR Forward GGGGAGGTTGTCGGGTTTATGG 60 493 0.3 2.5 40
Reverse CCGCACCCCTCCTTTAACATC
KvDMR1 Forward TGAGGAGTGAGTTATGAGGA (taurus) TGAGGATTGTAGTTGTGAGGA (indicus) 59.2 419/422 0.3 4 45
Reverse CTACCACATCTACCCCAATC
CDKN1C DMR Forward GAGGACTGGGCGTTCCACAGGCCA 62 1108 0.4 GC Buffer II Takara 35
Reverse GCCCTTTAACGGCCAGGAGGC
  1. Tm= Temperature in °C, bp= base pairs, [] = concentration.