Skip to main content

Table 1 Primer sequences for quantitative PCR

From: Mitofusion-2-mediated alleviation of insulin resistance in rats through reduction in lipid intermediate accumulation in skeletal muscle

Gene Forward primer (5'-3') Reverse primer (5'-3')
β-actin CGGTCAGGTCATCACTATCG GAAGGAAGGCTGGAAGAGAG
MFN2 AGCGTCCTCTCCCTCTGACA TTCCACACCACTCCTCCGAC
CPT1 CCAGGCAAAGAGACAGACTTG GCCAAACC TTAGAGAAGCGA
CD36 AATGAGACTGGGACCATCG CTCCAACACCAAGTAAGACCAT