Skip to main content

Table 1 Oligonucleotide primers used in real-time RT-PCR to amplify specific mRNAs together with sizes of amplified products

From: Tranilast enhances the anti-tumor effects of tamoxifen on human breast cancer cells in vitro

Target mRNA Sequence (5′ to 3′) Product size (bp)
GAPDH Forward actctggtaagtggatattgttgc 162
Reverse ggaagatggtgatgggatttc
BAX Forward tgtttgctgatggcaacttc 104
Reverse gatcagctcgggcactttag
BCL-2 Forward gggatgcctttgtggaacta 138
Reverse ctcacttgtggcccaggtat
TGF-β1 Forward tgaaccggcctttcctgcttctcatg 152
Reverse gcggaagtcaatgtacagctgccgc
TGF-β2 Forward atgcggcctattgctttaga 185
Reverse taagctcaggaccctgctgt
TGF-β3 Forward cagggagaaaatccaggtca 179
Reverse cctggaaggcgtctaaccaag
TGF-βR1 Forward atcacctggccttggtcctgtgg 140
Reverse ggtcctcttcatttggcactcgatg
TGF-βR2 Forward gtctactccatggctctggt 197
Reverse atctggatgccctggtggtt
TGF-βR3 Forward tacagagagaggtcacact 112
Reverse gtcttcagatgccacaccag