Table 1 Oligonucleotide primers used in real-time RT-PCR to amplify specific mRNAs together with sizes of amplified products
From: Tranilast enhances the anti-tumor effects of tamoxifen on human breast cancer cells in vitro
Target mRNA | Sequence (5′ to 3′) | Product size (bp) | |
|---|---|---|---|
GAPDH | Forward | actctggtaagtggatattgttgc | 162 |
Reverse | ggaagatggtgatgggatttc | ||
BAX | Forward | tgtttgctgatggcaacttc | 104 |
Reverse | gatcagctcgggcactttag | ||
BCL-2 | Forward | gggatgcctttgtggaacta | 138 |
Reverse | ctcacttgtggcccaggtat | ||
TGF-β1 | Forward | tgaaccggcctttcctgcttctcatg | 152 |
Reverse | gcggaagtcaatgtacagctgccgc | ||
TGF-β2 | Forward | atgcggcctattgctttaga | 185 |
Reverse | taagctcaggaccctgctgt | ||
TGF-β3 | Forward | cagggagaaaatccaggtca | 179 |
Reverse | cctggaaggcgtctaaccaag | ||
TGF-βR1 | Forward | atcacctggccttggtcctgtgg | 140 |
Reverse | ggtcctcttcatttggcactcgatg | ||
TGF-βR2 | Forward | gtctactccatggctctggt | 197 |
Reverse | atctggatgccctggtggtt | ||
TGF-βR3 | Forward | tacagagagaggtcacact | 112 |
Reverse | gtcttcagatgccacaccag | ||