Skip to main content

Table 2 Primers used for reverse transcription-PCR analysis in this study

From: Impact of glucose levels on expression of hypha-associated secreted aspartyl proteinases in Candida albicans

Primer Sequence (5′ to 3′) Reference
SAP4-1 TGCCGATGGTTCTGTTGCAC This study
SAP4-2 AACTTGAGCCATGGAGATCTTTC This study
SAP5-1 GCGGCGAAGCTACCGAGTTTG This study
SAP5-2 TACCACTAGTGTAATATGTTTGGA This study
SAP6a AAACCAACGAAGCTACCAGAAC [19]
SAP6b TAACTTGAGCCATGGAGATTTTC [19]
EFB1a AGTCATTGAACGAATTCTTGGCTG [19]
EFB1b TTCTTCAACAGCAGCTTGTAAGTC [19]