Skip to main content

Table 2 Primer information

From: Differential expression of microRNAs in decidua-derived mesenchymal stem cells from patients with pre-eclampsia

miRNA name Forward primer(5′-3′) Reverse primer (5′-3′)
miR-136-FP ACACTCCAGCTGGGACTCCATTTGTTTTG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCATCAT
miR-495-RP ACACTCCAGCTGGGAAACAAACATGGTG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAGAAGTG
miR-494-RP ACACTCCAGCTGGGTGAAACATACACGG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAGGTTTC
miR-16-RP ACACTCCAGCTGGGTAGCAGCACGTAAA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAATA
miR-29b-RP ACACTCCAGCTGGGTAGCACCATTTTGAAA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACTGA
miR-140-RP ACACTCCAGCTGGGCAGTGGTTTTACCC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCATA
miR-30a-RP ACACTCCAGCTGGGTGTAAACATCCTCG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTTCCAGT
miR-100-RP ACACTCCAGCTGGGAACCCGTAGATCCG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAGTT
miR-221-RP ACACTCCAGCTGGGAGCTACATTGTCTGC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAAACCA
miR-1207-RP ACACTCCAGCTGGGTGGCAGGGAGGCT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCCTCCC
U6snRNA CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
URP TGGTGTCGTGGAGTCG  
SOCS3 CCTGCGCCTCAAGACCTTC GTCACTGCGCTCCAGTAGAA
PPP2R2A CATACCAGGTGCATGAATACCTC GGGTTATGTCTCGCTTTGTGTTT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG