Skip to main content

Table 1 Primers for Oprl1 , Oprm1 and Gapdh for qPCR

From: Beneficial effects of co-treatment with dextromethorphan on prenatally methadone-exposed offspring

Gene Primer Sequence Position Product (bp) Reference
Oprl1 Forward CTGGGAGGTCTTGTATGG 268–360 93 Designed by software
Reverse CTGTGACTAGCATTGAGGA
Oprm1 Forward GTAGTGGGCCTCTTCGGAAAC 447–521 75 [59]
Reverse GTTGGTGGCAGTCTTCATTTG
Gapdh Forward AACGACCCCTTCATTGAC 169–359 191 [60]
Reverse TCCACGACATACTCAGCAC