Skip to main content

Table 2 Names, accession numbers and primer sequences used in the study

From: High fat diet-induced inflammation and oxidative stress are attenuated by N-acetylneuraminic acid in rats

Name Left sequence Right sequence
nfkb1 AGGTGACACTATAGAATACACTCCATATTTAATGCAGA GTACGACTCACTATAGGGAGAAATCCTCTCTGTTTCG
B2ma AGGTGACACTATAGAATAATGCTTGCAGAGTTAAACA GTACGACTCACTATAGGGATGCATAAAATATTTAAGGTAAGA
Hprt1a, b AGGTGACACTATAGAATATCCTCATGGACTGATTATG GTACGACTCACTATAGGGACTGGTCATTACAGTAGCTCTT
Rpl13aa AGGTGACACTATAGAATAATGGGATCCCTCCAC GTACGACTCACTATAGGGAATTTTCTTCTCCACATTCTT
Kan(r)c   
Sod1 AGGTGACACTATAGAATAATATGGGGACAATACACAA GTACGACTCACTATAGGGATCCAACATGCCTCTCT
Sod2 AGGTGACACTATAGAATACAGGTTGCTCTTCAGC GTACGACTCACTATAGGGAAACTCTCCTTTGGGTTCT
Gpx1 AGGTGACACTATAGAATATTGAGAAGTTCCTGGTAGGT GTACGACTCACTATAGGGATTTTCTGGAAATCAGGTGT
Gsr AGGTGACACTATAGAATAAATAAACTGGGGATTCAGAC GTACGACTCACTATAGGGAAGTAGATTTTCACATTGTCTTTG
CRP AGGTGACACTATAGAATACTAAACAGGCCTTCGTATT GTACGACTCACTATAGGGACAAGCCAAAGCTCTACAAT
  1. aHousekeeping genes. bNormalization gene. Underlined sequences are left and right universal sequences (tags). cinternal control supplied by Beckman Coulter Inc (Miami, FL, USA) as part of the GeXP kit. RT conditions were: 48 °C for 1 min; 37 °C for 5 min; 42 °C for 60 min; 95 °C for 5 min, then hold at 4 °C. PCR conditions were initial denaturation at 95 °C for 10 min, followed by two-step cycles of 94 °C for 30 s and 55 °C for 30 s, ending in a single extension cycle of 68 °C for 1 min