Skip to main content

Table 1 The sequences of primers and probes used in RT-qPCR

From: Virulence factors, antifungal susceptibility and molecular mechanisms of azole resistance among Candida parapsilosis complex isolates recovered from clinical specimens

Gene   Primers and probes
ACT1 F 5′- CGAACGTGGTTACGGTTTCT- 3’
R 5′- TGACCATCTGGCAATTCGTA - 3’
Probe TET-TGCAAACCTCATCACAATCA-MGB
CDR1 F 5′- GCTGTTGATCAAAGGGGTGT - 3’
R 5′- ATCCAAAATCCAGGCAACTG - 3’
Probe FAM- CTGATAATGCCGCCAATCTT-MGB
ERG11 F 5′- TGTTGCATTTGGCTGAGAAG - 3’
R 5′- TCTGAGGGTTTCCTTGATGG - 3’
Probe FAM-GGTAAAGGTGGCAACTTGGA-MGB
MDR1 F 5′- TCCCCATTGCTATTGTTGGT - 3’
R 5′- TGCGCCCATATAATTGAACA - 3’
Probe FAM- TTGGTCGGCAACGACATATA-MGB
MRR1 F 5′- CAGCTGCAACAACCACAACT - 3’
R 5′- TATCATCTAGGCCGCCATTC - 3’
Probe FAM- GCAACCACAGCCTATAGGGA-MGB