Skip to main content

Table 1 Primers used for RT-PCR

From: Tumor necrosis factor superfamily ligand mRNA expression profiles differ between humans and mice during homeostasis and between various murine kidney injuries

Heading Forward Sequence (5´➔3′) Reverse Sequence (3´➔ 5′) Accession Nr. Efficiency
Human
 TNF-α ATGGGCTACAGGCTTGTCACTC CTCTTCTGCCTGCTGCACTTTG NM_ 000594 1.80
 LT-α TCCGTGTTTGCTCTCCAGAGCA ACACCTTCAGCTGCCCAGACTG NM_ 000595 1.8
 LT-β CGTCAGAAACGCCTGTTCCTTC GGTTTCAGAAGCTGCCAGAGGA NM_ 000595 1.97
 Fas-L CTGTGTGCATCTGGCTGGTAGA GGTTCTGGTTGCCTTGGTAGGA NM_000639 1.98
 TRAIL AGCTGCTACTCTCTGAGGACCT TGGCAACTCCGTCAGCTCGTTA NM_003810 1.73
 TWEAK TGGAGCTGTTGATTCTGGCTTCC AAAACACGGGCTCGAAGAGCGA NM_003809 2.14
 4-1BBL TGGAAATCGGCAGCTACAGCCA TCTTCCTCACGCTCCGTTTCTC NM_003811 2.08
 OX40-L TGATGACTGAGTTGTTCTGCACC CCTACATCTGCCTGCACTTCTC NM_003326 2.10
 APP CCTTCTCGTTCCTGACAAGTGC GGCAGCAACATGCCGTAGTCAT NM_000484 2.15
Mouse
 TNF-α GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG NM_013693 2.20
 LT-α AGCCCATCCACTCCCTCAGAAG TGCTCTCCAGAGCAGTGAGTTC NM_010735 1.94
 LT-β CCTGTTGTTGGCAGTGCCTATC GACGGTTTGCTGTCATCCAGTC NM_008518 2.22
 Fas-L GCCACACTCCTCGGCTCTTTTT GAAGGAACTGGCAGAACTCCGT NM_010177 2.12
 TRAIL TGGAGTCCCAGAAATCCTCA TCACCAACGAGATGAAGCAG NM_009425 1.95
 TWEAK ACACCGTTCACCAGCAAGTCCA CTGCGCTACGACCGCCAGATT NM_013749 1.93
 4-1BBL GCGTTGTGGGTAGAGGAGCAAA CCAAGTACCTTCTCCAGCATAGG NM_009404 2.06
 OX40-L CTGGTAACTGCTCCTCTGAGTC GGAAGAAGACGCTAAGGCTGGT NM_009452 1.81
 APP GCCAAGACATCGTCGGAGTAGT TCCGTGTGATCTACGAGCGCAT NM_177310 2.11