Skip to main content

Advertisement

Table 1 A summary of aptamers selected against bacterial cells or toxins using SELEX technique, since 2015 till today

From: Therapeutic applications of nucleic acid aptamers in microbial infections

Target typeAptamer NameTargetAptamer TypeSequence of the Aptamer (5′ to 3′)Kd (nM)Ref
BacteriaLyd-3S. pneumoniaeDNATGACGAGCCCAAGTTACCTGCCCCCGAACCATACCACACG
ATGCCCCGTACCCCAGCCACCAGAATCTCCGCTGCCTACA
661.8 ± 111.3[29]
Apt3S. choleraesuisDNAGGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG41 ± 2[11]
BB16-11fB. breveaDNACTCCCAGGCCGTTGGGGCGTTGCCTGCGT18.66 ±
1.41
[30]
CCFM641–5B. bifidumbDNATGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC10.69 ± 0.89[18]
SAL 26S.typhimuriumDNATAGCTCACTCATTAGGCACATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGTGCATAGTTAAGCCAGCC123 ± 23[31]
Bacterial toxinCT916cholera toxinDNAGGCAAAAAGGATTGCCCAGGTCTGCTGTCTAGCCGGATTC48.5 ± 0.5[32]
S3SEADNACCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG36.93 ± 7.29[33]
ML12LFDNACGAGGGAGACGCGAACCTTCTCGCCTTGGG11.0 ± 2.7[34]
C10enterotoxin C1DNAAGCAGCACAGAGGTCAGATGTATACTTCTAAAATTTGTTTGT
ATCTACGATGTTCTTCGTCCTATGCGTGCTACCGTGAA
65.14 ± 11.64[35]
  1. aBifidobacterium. Breve (B. breve)
  2. bBifidobacterium. Bifidum (B. bifidum)