Skip to main content

Table 1 A summary of aptamers selected against bacterial cells or toxins using SELEX technique, since 2015 till today

From: Therapeutic applications of nucleic acid aptamers in microbial infections

Target type Aptamer Name Target Aptamer Type Sequence of the Aptamer (5′ to 3′) Kd (nM) Ref
Bacteria Lyd-3 S. pneumoniae DNA TGACGAGCCCAAGTTACCTGCCCCCGAACCATACCACACG
ATGCCCCGTACCCCAGCCACCAGAATCTCCGCTGCCTACA
661.8 ± 111.3 [29]
Apt3 S. choleraesuis DNA GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG 41 ± 2 [11]
BB16-11f B. brevea DNA CTCCCAGGCCGTTGGGGCGTTGCCTGCGT 18.66 ±
1.41
[30]
CCFM641–5 B. bifidumb DNA TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC 10.69 ± 0.89 [18]
SAL 26 S.typhimurium DNA TAGCTCACTCATTAGGCACATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGTGCATAGTTAAGCCAGCC 123 ± 23 [31]
Bacterial toxin CT916 cholera toxin DNA GGCAAAAAGGATTGCCCAGGTCTGCTGTCTAGCCGGATTC 48.5 ± 0.5 [32]
S3 SEA DNA CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG 36.93 ± 7.29 [33]
ML12 LF DNA CGAGGGAGACGCGAACCTTCTCGCCTTGGG 11.0 ± 2.7 [34]
C10 enterotoxin C1 DNA AGCAGCACAGAGGTCAGATGTATACTTCTAAAATTTGTTTGT
ATCTACGATGTTCTTCGTCCTATGCGTGCTACCGTGAA
65.14 ± 11.64 [35]
  1. aBifidobacterium. Breve (B. breve)
  2. bBifidobacterium. Bifidum (B. bifidum)