Skip to main content

Table 1 Primer list

From: Enhanced NETosis generation in radiographic axial spondyloarthritis: utility as biomarker for disease activity and anti-TNF-α therapy effectiveness

Primer Supplier Sequence 5′-3´
Forward Reverse
GADPH Sigma-Adrich, Steinheim, Germany TGTAGTTGAGGTCAATGAAGGG ACATCGCTCAGACACCATG
STAT-3 IDT, Leuven, Belgium AGGCATTTGGCATCTGACAG TGCTTCCCTGATTGTGACTG
TNF-α IDT TCAGCTTGAGGGTTTGCTAC TGCACTTTGGAGTGATCGG
IL-1β Qiagen, Hiden, Germany Not provided by the manufacturer Not provided by the manufacturer
IL-1α IDT AGTTCTTAGTGCCGTGAGTTTC GTGACTGCCCAAGATGAAGA
IL-6 IDT GCCCCACACAGACAGCCACTCACC TGCCTCTTTGCTGCTTTCACACAT
IL-23 IDT GGCGCAGAGCCAGCCAGATT ACCCTCAGGCTGCAGGAGTTGG
  1. GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; STAT, signal transducer and activator of transcription; TNF, tumor necrosis factor