Skip to main content

Table 1 Primer list

From: Enhanced NETosis generation in radiographic axial spondyloarthritis: utility as biomarker for disease activity and anti-TNF-α therapy effectiveness

PrimerSupplierSequence 5′-3´
ForwardReverse
GADPHSigma-Adrich, Steinheim, GermanyTGTAGTTGAGGTCAATGAAGGGACATCGCTCAGACACCATG
STAT-3IDT, Leuven, BelgiumAGGCATTTGGCATCTGACAGTGCTTCCCTGATTGTGACTG
TNF-αIDTTCAGCTTGAGGGTTTGCTACTGCACTTTGGAGTGATCGG
IL-1βQiagen, Hiden, GermanyNot provided by the manufacturerNot provided by the manufacturer
IL-1αIDTAGTTCTTAGTGCCGTGAGTTTCGTGACTGCCCAAGATGAAGA
IL-6IDTGCCCCACACAGACAGCCACTCACCTGCCTCTTTGCTGCTTTCACACAT
IL-23IDTGGCGCAGAGCCAGCCAGATTACCCTCAGGCTGCAGGAGTTGG
  1. GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; STAT, signal transducer and activator of transcription; TNF, tumor necrosis factor