Skip to main content

Table 1 Real-time quantitative PCR primers and length of products

From: Premature senescence of placental decidua cells as a possible cause of miscarriage produced by mycophenolic acid

β-actina Forward sequence (5′ to 3′): AGAGCTACGAGCTGCCTGAC
Reverse sequence (5′ to 3′): AGCACTGTGTTGGCGTACAG
84 bp
45 S Forward sequence (5′ to 3′): CGTGGTGTGAAACCTTCCGA
Reverse sequence (5′ to 3′): CCCAAGAGGAGAGGGGGTT
91 bp