Skip to main content

Table 1 Real-time quantitative PCR primers and length of products

From: Premature senescence of placental decidua cells as a possible cause of miscarriage produced by mycophenolic acid

β-actina

Forward sequence (5′ to 3′): AGAGCTACGAGCTGCCTGAC

Reverse sequence (5′ to 3′): AGCACTGTGTTGGCGTACAG

84 bp

45 S

Forward sequence (5′ to 3′): CGTGGTGTGAAACCTTCCGA

Reverse sequence (5′ to 3′): CCCAAGAGGAGAGGGGGTT

91 bp