Open Access

Mitochondrial genotype in vulvar carcinoma - cuckoo in the nest

  • Aleksandra Klemba1, 2,
  • Magdalena Kowalewska3,
  • Wojciech Kukwa4,
  • Katarzyna Tonska1,
  • Aleksandra Szybinska5,
  • Malgorzata Mossakowska5,
  • Anna Scinska4,
  • Paweł Golik1, 6,
  • Kamil Koper1,
  • Jakub Radziszewski7,
  • Andrzej Kukwa4,
  • Anna M Czarnecka1, 2Email author and
  • Ewa Bartnik1, 6
Journal of Biomedical Science201017:73

DOI: 10.1186/1423-0127-17-73

Received: 5 February 2010

Accepted: 8 September 2010

Published: 8 September 2010

Abstract

Vulvar squamous cell carcinoma (VSCC) is a rare female genital neoplasm. Although numerous molecular changes have been reported in VSCC, biomarkers of clinical relevance are still lacking. On the other hand, there is emerging evidence on the use of mtDNA as a diagnostic tool in oncology. In order to investigate mtDNA status in VSCC patients, haplogroup distribution analysis and D-loop sequencing were performed. The results were compared with available data for the general Polish population, cancer free-centenarians as well as patients with endometrial and head and neck cancer. The obtained data were also compared with the current status of mitochondrial databases. Significant differences in haplogroup distribution between VSCC cohort, general Polish population and cancer-free centenarians cohort were found. Moreover, a correlation between the VSCC patients haplogroup and HPV status was observed. Finally, a specific pattern of mtDNA polymorphisms was found in VSCC. Our results suggest that the mitochondrial genetic background may influence the risk of VSCC occurrence as well as susceptibility to HPV infection.

Introduction

Vulvar squamous cell carcinoma (VSCC) is a rare female genital neoplasm - it is 2.5% of cancer cases among women, and 5% of all gynecological cancers, which is the 4th ranking cause of morbidity - after breast, cervix and endometrial carcinomas [1]. Today two models of vulvar tumorigenesis are accepted: HPV-associated pathway and HPV-independent pathway. Unfortunately molecular data on VSCC are fragmentary and incoherent [2, 3].

Mitochondrial dysfunction has been linked to a wide range of degenerative and metabolic diseases, cancer, and aging with its genome (mtDNA) being considered as "Pandora's box" of pathogenic mutations and polymorphisms [4, 5]. MtDNA has a very high mutation rate, which results in three classes of clinically relevant phenotypes. Deleterious germline line mtDNA mutations are linked to mitochondrial diseases, mtDNA polymorphisms are linked to environmental adaptation in human evolution and mtDNA somatic mutations are linked with aging and cancer [6, 7]. Mitochondrial defects were first associated with carcinogenesis several decades ago, when Warburg reported 'injury of the respiratory chain' and high glycolysis rate as typical of cancer [8]. Until now the role of mitochondria in neoplasm formation is supported by a growing body of evidence. Today mitochondrial dysfunction does appear to be a factor in cancer etiology [912]. Alterations in the mitochondrial genome (mtDNA), including point mutations, deletions, insertions, and genome copy number changes, are believed to be responsible for this phenomenon [1317]. It is for the fact that mitochondria are pivotal to cell metabolism, but also to regulating cellular signal transduction pathways. It is now postulated that reactive oxygen species (ROS) provide the interface between the mtDNA mutations and cancer progression [1820].

Mutations have been found in cell lines and tumor-derived samples. Reported mtDNA mutations and polymorphisms were shown to be localized in the entire mitochondrial genome. Nevetheless the highest mutation rate was reported for the displacement loop (D-loop) sequence - the control region of mtDNA, and its two hypervariable regions: HV1 (nucleotides 16024-16383) and HVII (57-372) [10, 13, 21, 22]. High frequency of mtDNA mutations have been reported in variety of cancer types including: bladder, breast, colon, head and neck, liver, lung, prostate, and thyroid cancer. MtDNA alterations are also found in gynecological cancers. Wang et al. analyzed 12 mtMSI (mitochondrial instability) regions in cervical, endometrial and ovarian cancer and found that 95.6% of alterations localized in the D-loop [23]. In endometrial carcinoma the occurrence of mtMSI in position 303-315 was shown to correlate with an increased mtDNA content, when normal endometrium and tumor samples were compared [24]. Moreover, somatic mutations in the D-loop, 12 S rRNA and 16 S rRNA sequences were found to be frequent in this type of cancer [25]. The inheritance of mtDNA with haplogroup-D specific polymorphisms localized in the D-loop was shown to increase the risk of endometrial cancer development [26]. The D-loop and cytochrome b gene (cytB) were shown to be mutated in 20% of ovarian cancer cases [27]. We have previously shown that as many as 57% of Polish ovarian cancer patients carry somatic mutations in D-loop. Although mutations reported in that study did not correlate with patients' medical history, the mtDNA content in tumor samples was significantly increased in comparison to control - noncancerous ovarian tissue [28].

For several reasons mtDNA seems to be a good target of clinical analyses [9, 29, 30]. MtDNA is present in thousands of copies within the cell, therefore an infinitesimal amount of the tissue is needed for successful analysis and minimally-invasive procedures may be used to obtain diagnostic material [31, 32]. Moreover, mtDNA alterations are easily detectible not only in the tumor sample, but also in body fluids [33]. At the same time, mtDNA mutation and polymorphism analyses are relatively fast and cost-effective [34].

To our best knowledge until today no VSCC patients has been performed. In our opinion, such an experiment fills the gap in gynecological mitochondrial oncology. As a first step to accomplish this goal we screened D-loop of VSCC samples in order to identify somatic mutations and a pattern of inherited polymorphisms Our step was of specificity of haplogroup distribution among SC. Finally, the last step of the study included correlation analysis of molecular characteristics and patients' medical history.

Materials and methods

Analyzed cases

Cancer cohorts

Tumor samples and control tissue form VSCC cases were obtained in The Maria Sklodowska-Curie Memorial Cancer Centre in Warsaw. The patients were treated for VSCC under standard protocols between 2002 and 2006. Surgery was performed as described previously [35]. All patients enrolled in the study had histopathologically confirmed invasive VSCC of (Table 1). Apart from two patients with a history of ovarian cancer stage III, patients had not previously been treated for any malignancy. Altogether 25 paired tumor and blood samples were investigated. In five cases the tumor margin was also available for analysis. Genomic DNA was isolated from approximately 25 mg of each pulverised with a Microdismembrator II (B Braun Biotech International) sample with a NucleoSpin Tissue kit (Macherey Nagel Inc.) according to the manufacturer's protocol. The presence and genotyping of HPV was performed using Linear Array HPV Detection Kit and Linear Array HPV Genotyping Test (Roche Molecular Systems, Inc) as described previously [36].
Table 1

Clinical characteristics of the investigated group of VSCC patients.

Parameter

Number of cases

Age

<55

1(4%)

 

>55

24(96%)

Tumor size

T1

4(16%)

 

T2

17(68%)

 

T3

3(12%)

Metastasis

M0

25 (100%)

 

M1

0 (0%)

Lymph node status

N0

15 (60%)

 

N1

4 (16%)

 

N2

1 (4%)

 

NX

5 (20%)

HPV infection*

positive

5 (21%)

 

16

3(12%)

 

58

1(4,%)

 

6

1(4%)

 

negative

19(79%)

*the HPV status of one of the patients was unknown

The head and neck patients and endometrial adenocarcinoma patients were recruited as described previously [12, 34].

Control cohorts

The DNA of 84 healthy centenarians was obtained from the Polish Centenarians project DNA-bank localized in The International Institute of Molecular and Cell Biology in Warsaw. All centenarians had negative cancer medical history and negative family history of cancer [37].

General Polish population data was obtained from our previous analysis [38] and the analysis performed by Malyarchuk et al. [39].

All investigated populations share the same ethnicity, nationality, parentage, descent and reside in Poland. This study did not include any patients of Asian, African-American or Jewish origin [34].

The mtDNA research project was approved by the local Ethics Committee at the Medical University of Warsaw, Poland (KB-0/6/2007 to AMC, and KB-0/7/2007 to WK). The VSCC project was approved by the local Ethics Committee of the Cancer Center at the Institute of Oncology (44/2002 to JR). The centenarians' project was approved by local Ethics Committee of the Central Clinical Hospital of the Military Medical Academy (currently Military Medical Institute) in Warsaw. The Centenarians Database was registered at the Bureau of the Inspector General for the Protection of Personal Data in May 1999.

Polymorphisms and mutations analysis

The mtDNA sequences were obtained from tumor, blood and normal tissue (tumor margin) and aligned to the revised Cambridge Reference Sequence (rCRS) and sequence variants were recorded [40, 41]. Germline (inherited) polymorphism was defined as a difference between normal tissue sequence and rCRS. Polymorphism is present both in normal and tumor tissues of a particular patient. Whenever the difference between mtDNA sequences obtained from tumor sample and normal tissue (blood or margin) occured, it was defined as a somatic mtDNA mutation. All described mtDNA alterations were plotted against data from mtDB (35) and MITOPAP databases [41, 42].

D-loop sequence analysis

D-loop region (mtDNA 16024-576) was amplified with three overlapping pairs of primers (Table 2). Each of the forward primers contained FM13 (TGTAAAACGACGGCCATG) sequence at the 5' site, and each of the reverse primers contained RM13 (CAGAGGACAGCTATGACC) tail at the 5' site. PCR was carried out in a MJ Research Dyad dual block thermocycler (Bio-Rad) with the following cycling conditions: initial incubation 3'at 95°C, followed by 30 cycles: (30" 95°C, 30" 55°C, 1' 72) with a final extension step for 7' at 72°C. Two microlitres of the PCR product were analyzed on an ethidium bromide-stained 1.5% agarose gel (30' 80 V) for quantification purposes. Sequencing reactions were carried out at Oligo.pl©.
Table 2

Primers used in D-loop sequencing.

Primer name

Primer sequence

Position in mtDNA

FM13.D1F

AATGGGCCTGTCCTTGTAG

15879-15897

RM13.D1R

AACGTGTGGGCTATTTAGGC

16545- 16526

FM13.D2F

CGACATCTGGTTCCTACTTC

16495-16514

RM13.D2R

GGGTTTGGTTGGTCCGGG

559-542

FM13.D3F

CGCTTCTGGCCACAGCAC

315-332

RM13.D3R

GGTGTGGCTAGGCTAAGC

803-786

The quality of the obtained chromatograms was assessed in FinchTV® software version 1.4.0 (Geospiza Inc., USA). All sequences were analyzed and corrected manually when necessary. Subsequently chromatograms were imported into Sequencher® 4.1.4 software (Gene Codec Corporation, Ann Arbor, MI USA) and D-loop contigs were assembled (minimal overlap 20 bp, 85% of identity).

Haplotyping by RFLP and D-loop analysis

The patterns of specific polymorphisms in mtDNA determine classes of related genotypes, referred to as haplogroups (H, I, J, K, T, U, V, W, X; Table 3). The mtDNA fragments containing polymorphic sites characteristic for specific haplogroups were amplified by PCR according to the following cycling conditions: initial incubation for 3' at 95°C, followed by 35 cycles (30" 95°C, 30" 55°C, 1' 72) with a final extension step for 7' at 72°C. One microlitre of PCR product was analyzed on an ethidium bromide-stained 1.5% agarose gel (30' 80 V) and then digested by appropriate restriction enzymes (overnight, 37°C). The digestion products were analyzed on an ethidium bromide-stained 2.5% agarose gel (75', 60 V). Tree diagram was used to facilitate haplogroup analysis [43]. In addition to canonical loci (Table 3 - positions 1-14), new RFLP reactions were designed for the project and additional positions in mtDNA were also investigated (Table 3 - positions 14-22) [41, 4345]. In addition to coding sequence analysis the D-loop sequence was also analyzed in order to establish haplotype of each patient. The haplogroup assignment was done as previously published [11, 28]. Finally it was also validated with mtDNA search engine [46].
Table 3

RFLP haplogroup analysis.

 

Haplogroup

Polymorphism

Enzyme

Primer F

Primer R

Primer F - sequence

Primer R - sequence

PCR product

RFLP DNA fragments if this haplogroup

RFLP DNA fragments if not this haplogroup

1

H

C7028T

Alu I

6730F

7398R

CTATGATATCAATTGGCTTCC

GGCATCCATATAGTCACTCC

669

342, 158, 139, 30

342, 188, 139

2

U/K

A12308G

Hinf1

11902F

12328R

GCTAGTCCACGTTCTCCT

TTTGGAGTTGCACCAAGAATT

427

162, 158, 59, 48

221, 158, 48

3

K

G9055A

HaeII

8563F

9231R

ACAATCCTAGGCCTACCCG

GATAGGCATGTGATTGGTGG

669

669

494, 175

4

I

G16398A

BamHI

15879F

16545R

AATGGGCCTGTCCTTGTAG

AACGTGTGGGCTATTTAGGC

667

511, 156

667

5

I

T10031C

Alu I

9821F

10516R

ACTTCACGTCATTATTGGCTC

ATGGAGATGGTAATTGCTAG

696

283, 209, 204

413, 283

6

I

G8251A

AvaII

7960F

8641R

ATTATTCCTAGAACCAGGCG

TGATGAGATATTTGGAGGTGG

682

392, 290

682

7

I

A4529T

HaeII

4184F

4869R

TCCTACCACTCACCCTAGC

GTCATGTGAGAAGAAGCA

686

686

350, 336

8

W

G8994A

HaeIII

8563F

9231R

ACAATCCTAGGCCTACCCG

GATAGGCATGTGATTGGTGG

669

266, 205, 187, 11

266, 205, 156, 31, 11

9

T

A15607G

AluI

15372F

16067R

TAGGAATCACCTCCCATTCC

GTCAATACTTGGGTGGTACC

696

236, 218, 170, 72

406, 218, 72

10

T

G13368A

BamHI

12951F

13614F

CGCTAATCCAAGCCTCACC

TATTCGAGTGCTATAGGCGC

691

691

416, 248

11

J

G13708A

BstNI

13568F

14276R

TTACTCTCATCGCTACCTCC

GGTTGATTCGGGAGGATCC

709

709

571, 138

12

J

C16069T

Hinf1

15879F

16545R

AATGGGCCTGTCCTTGTAG

AACGTGTGGGCTATTTAGGC

667

480, 122, 65

602, 65

13

V

G4580A

NlaIII

4184F

4869R

TCCTACCACTCACCCTAGC

GTCATGTGAGAAGAAGCA

686

684, 2

397, 287, 2

14

X

G1719A

DdeI

1138F

1801R

GAACACTACGAGCCACAGC

TCATCTTTCCCTTGCGGTAC

664

188, 187, 134, 111, 30, 14

188, 187, 111, 86, 48, 30, 14

15

W1

A11947G

BsmFI

11765F

12108R

GCACTCACAGTCGCATCATAA

TTGAGGGATAGGAGGAGAATG

343

196, 149

343

16

M

C10400T

AluI

10381F*

10671R

AAAAAGGATTAGACTGAGCTGA

CGGCAAAGACTAGTATGGCAA

318

201, 172, 18

219, 72

17

J, T, L2, H

T4216C

NlaIII

4142F

4379R

GATTCCGCTACGACCAACTC

GCACGGAGAATTTTGGATTC

197

160, 78

197

18

HV

C14766T

MseI

14642F

14968R

CCCACACTCAACAGAAACAAA

AGCGGATGATTCAGCCATAA

346

203, 142, 4

203, 125, 17, 4

19

U/K

A1811G

PsiI

1623F

1909R

GCACCCAACTTACACTTAGGA

TTTCGGGGGTCTTAGCTTT

287

287

188, 101

20

K

A10550G

NlaIII

10387F

10761R

GATTAGACTGAACCGAATTGG

CGGCAAAGACTAGTATGGCAA

285

164, 121

285

21

T

A4917G

BfaI

4865F

5192R

ATGACAAAAACTAGCCCCCA

AGGGTGGATGGAATTAAGGGT

348

298, 39, 11

337, 11

22

X

T6221C

Mnl I

5881F

6254R*

GCCATTTTACCTCACCCCCACTGATGTTCG

TATAGCAGATGCGAGCAGGAGTAGGAGATAGGGA

374

131, 115, 108, 20

115, 108, 106, 25, 20

Restriction enzymes and primers used indicated. * mismatched primers.

Statistical analysis

Two tailed non-directional Fisher-Irwin (Fisher's exact test) was used for statistical analysis [47]. Statistical analysis was performed with PAST (PAlaeontological Statistics) software ver. 1.34 (Øyvind Hammer, D.A.T. Harper and P.D. Ryan, 2005) and Analyse-it for Microsoft Excel General & Clinical Laboratory modules Version 1.73 (Analyse-it Software, Ltd. Copyright © 1997-2005). The difference was considered statistically significant if p < 0.05. To confirm the result of Fisher's test - Yates's chi and un-corrected chi squared test ('N - 1' chi squared test) were used to give relatively low Type I error in the case of a small number of cases analyzed. The statistics was performed as previously recommended by Campbell [48]. To further calculate the significance of specific polymorphisms as factors of favorable outcomes (odds ratio, relative risk, difference in proportions, absolute and relative reduction in risk) and the effectiveness of a diagnostic criterion (number needed to diagnose, specificity, positive and negative predictive values, positive and negative likelihood ratios, diagnostic and error odds ratios) additional analyses have been performed. These parameters, as well as the confidence intervals for the estimated parameters were computed by general methods [49, 50].

Results

Haplogroup analysis

Haplogroup distribution in the group of 25 VSCC patients is shown in Figure 1A: seven patients (27%) belong to haplogroup H, eight (32%) to haplogroup U, three (12%) to K and T, two (9%) to W, and one (4%) to haplogroup J. O ne patient (4%) could not be classified to any investigated European haplogroup, due to unspecific polymorphisms pattern. Haplogroup assessment with the mtDNA search engine [46] revealed that this patient probably harbors mtDNA polymorphisms characteristic for East Asian haplogroup Y1b, which suggested other than Polish descent [51]. No patients were found to be classified haplogroup I, V and × members. As expected [44, 52], no patient showed a positive RFLP pattern for haplogroup M.
https://static-content.springer.com/image/art%3A10.1186%2F1423-0127-17-73/MediaObjects/12929_2010_Article_187_Fig1_HTML.jpg
Figure 1

Haplogroup distribution in the studied group of VSCC patients (A) and haplogroup distribution in control populations: cancer free centenarians - (B) and head and neck cancer patients (C).

In order to verify haplogroup distribution in the VSCC cohort differs from that of the healthy Polish population and whether any similarities to the other cancer comparisons were made: 1. with general Polish population (PP and NP) [38, 39], 2. with cancer-free centenarians (CENT), 3. with head and neck cancer (HNC) 4. with endometrial adenocarcinoma cohort (EA) [53] (Tables 4 and 5). First of all, the underrepresentation of haplogroup H in the VSCC cohort was found. In other words haplogroup H was overrepresented in healthy individuals (cancer free centenarians - CENT). Moreover, in the comparison with the combined general Polish population (COMB), a trend towards haplogroup U overrepresentation was also noticed. A trend for haplogroup K overrepresentation was also found. When further comparison of super-haplogroup UK (encompassing haplogroup U1-U7 and haplogroup K) frequency was made (Table 6), its overrepresentation in VSCC patients became highly significant (44 vs. 19%, p = 0.009). Finally, a comparison with cancer free centenarians shows a trend of overrepresentation of haplogroup W in the VSCC cohort (Table 4, Figure 1A and 1B). As expected, the distribution of haplogroups in VSCC is similar to other studied cancer groups (HNC and EA).
Table 4

Analysis of the specificity of haplogroup distribution in VSCC cohort.

    

1

2

3

4

5

6

Positive

Negative

% positive

p vs PP

p vs NP

p vs COMB

p vs CENT

p vs HNC

p vs EA

H

7

18

28%

0.502

0.102

0.152

0.023 U

0.39

0.173

I

0

25

0%

1

1

1

0.194

1

1

J

1

24

4%

0.697

0.7

0.712

1

1

0.191

K

3

22

12%

0.381

0.067

0.092

0.693

0.333

1

NN

1

24

4%

1

0.547

0.552

ND

0.613

0.61

T

3

22

12%

1

1

1

0.712

1

0.668

U

8

17

32%

0.3

0.052

0.104

0.01 O

0.761

0.764

V

0

25

0%

0.368

0.385

0.389

1

1

1

W

2

23

8%

0.147

0.254

0.209

0.051

0.218

1

X

0

25

0%

1

1

1

1

1

1

Total

25

        

Haplogroup distribution in VSCC patients cohort was were compared with 1) the general Polish population (p vs PP) [38], 2) population from the Northern Poland (p vs NP) [39], 3) those two populations combined (p vs COMB), 4) cancer free centenarians cohort (p vs CENT), 5) head and neck tumors patients cohort (p vs HNC), and 6) endometrial adenocarcinoma patients cohort (p vs EA) [11]. % positive - percentage of patients carrying particular haplotype in VSCC cohort. Significant differences - bolded: O - overrepresented in VSCC cohort, U - underrepresented in VSCC cohort.

Table 5

Analysis of the specificity of haplogroup distribution HNC cohort.

  

1

2

3

4

6

% positive

p vs PP

p vs NP

p vs COMB

p vs CENT

p vs EA

H

0.43

0.67

0.847

1

0.286

0.015

I

0

1

1

1

0.197

1

J

0.07

1

1

1

1

0.243

K

0.04

1

1

1

0.677

0.184

NN

0.11

0.11

0.065

0.065

ND

1

T

0.11

1

1

1

1

1

U

0.25

0.62

0.29

0.31

0.053

1

V

0

0.22

0.629

0.389

1

1

W

0

1

0.614

1

1

0.227

X

0

1

1

1

1

1

Haplogroup distribution in VSCC patients cohort was were compared with 1) the general Polish population (p vs PP) [38], 2) population from the Northern Poland (p vs NP) [39], 3) those two populations combined (p vs COMB), 4) cancer free centenarians cohort (p vs CENT), 5) head and neck tumors patients cohort (p vs HNC), and 6) endometrial adenocarcinoma patients cohort (p vs EA) [11]. % positive - percentage of patients carrying particular haplotype in VSCC cohort. Significant differences - bolded: O - overrepresented in VSCC cohort, U - underrepresented in VSCC cohort.

Table 6

Comparison of UK super-haplogroup frequency between VSCC and 1) the general Polish population [38], 2) population from Northern Poland [39], and 3) those two populations combined.

 

1

2

3

p vs PP

p vs NP

p vs COMB

Fisher two-tailed

0.099

0.009

0.000

Fisher L

0.973

0.998

1.000

Fisher R

0.070

0.006

0.000

Significant differences - bolded.

The underrepresentation of haplogroup H in the VSCC cohort was particularly interesting. Haplogroup H is marked by T7028C polymorphism. Therefore, if haplogroup H is underrepresented in the VSCC cohort, 7028T polymorphism is overrepresented. This suggests that a positive RFLP test (7028T) may indicate an increased susceptibility to VSCC. In order to check the properties of this RFLP test additional analyses were performed. VSCC harbour 7028C in 28% of cases, while centenarians carry single nucleotide polymorphism (SNP) 7028C in 55% cases. The difference is significant at p = 0.023 with Fisher's exact test. This significance is further confirmed with Yates corrected chi square test, with χ2= 4.50 and p = 0.034, but also with 'N-1' chi square test, with χ2 = 'N-1' and chi square = 5.47 and p = 0.02. he 7028T test has Odds Ratio (OR) and Diagnostic Odds Ratio = 3.11 and indicates Relative Risk (RR) = 2.43 in comparison to cancer free centenarians. Moreover, this test seems cost-effective as Number Needed to Diagnose (NND) is 3.73. The Positive Predictive Value (PPV) of the test is 0.32 at sensitivity 0.72, while the negative predictive value (NPV) is 0.67 and relative risk reduction (RRR) is 0.59.

Sequencing data analysis

Germ-line polymorphisms in the mtDNA D-loop region in VSCC

Altogether 25 paired mtDNA D-loop sequences from both tumor and blood samples were sequenced. The results are summarized in Table 7. The group of VSCC patients is characterized by 78 germ-line polymorphism (differences haplogroup H - rCRS) [40]. In particular 19 out of 78 polymorphisms are generally uncommon [42] and one polymorphism had not been reported previously (C498delC). Polymorphisms were predominantly found in mtDNA hypervariable regions HV1 (16024-16383) and HV2 (57-333) - 42/78 (54%) and 23/78 (29.5%) polymorphisms, respectively (Table 7, Figure 2A and 2B). Eight (10%) SNPs were localized in HV3 (438-574). The analysis of the control region haplogroup specific loci revealed significant overabundance of certain polymorphisms in the investigated VSCC group of patients. These overrepresented polymorphisms include C16192T, C16256T and C16270T, all being specific for haplogroup U, which is in accordance with the trend observed by haplogroup comparison (Table 6 and Figure 1). The other overrepresented SNPs include 195C, 259G, 477C, 498delC, 533C, 16092G, 16189A, 16248T, 16272G, 16362C. The 16223T sequence variant, characteristic for haplogroups I, W and X, was underrepresented in the VSCC cohort, again reflecting the haplogroup distribution trend. All those results suggest that specific polymorphisms may be found in VSCC. These polymorphisms include not only haplogroup-specific polymorphisms (Figure 1.), but also D-loop polymorphisms (Table 7). No somatic mutations were found.
Table 7

Germ-line polymorphisms in the D-loop sequence of VSCC patients.

mtDNA

position

(rCRS)

Polymorphism

Case No

No

A/G/C/T/del frequency mtDB

Tissue where sequence was found

P-value

Region/population where sequence variant predominantly found

73

A > G

15,16,17,25, 26,27,29,30,

38,40,41,42,

45,46,49,50,51

17

309/1555/1/0/0

pancreatic cancer,

thyroid tumor,

oral cancer aging brains, POLG/PEO & control muscle,

0.056

Very common

93

A > G

27

1

1824/41/0/0/0

ovarian cancer

0.432

Japan Finland,

Italy India

97

G > A

33

1

Nd

Polymorphism

-

Nd

103

GCC > DEL GCC

33

1

Nd

oral cancer

-

Nd

111

A > C

33

1

Nd

Polymorhism

-

Nd

146

T > C

15,33,49,51

4

1/0/190/1674/0

prostate tumor, ovarian carcinoma elderly fibroblasts, aging/AD brains,

POLG/PEO & control muscle,

0.316

Africa, Japan, Taiwan, Finland, Italy, Spain, Algerian Jew, India, Polynesia, Caucasi

150

C > T

16,41,50

3

0/2/1616/247/0

lung tumor,

thyroid tumor elderly fibroblasts/leukocytes

1

China, Japan, Berbers, Italy

151

C > T

16

1

0/0/1817/48/0

Polymorphism

0.484

Japan, Finland, Sweden, India

152

T > C

13,26,33,49

4

0/0/396/1469/0

pancreatic cancer, ovarian carcinoma, oral cancer

aging brains, elderly fibroblasts,

0.803

Africa, China, Japan, American, Finland, Italy

189

A > G

26,29

2

1782/75/8/0/0

prostate tumor elderly muscle, POLG/PEO muscle

& fibroblasts, aging brains

0.271

Japan, Finland, India

194

C > T

26,29

2

0/0/1797/68/0

POLG/PEO muscle

0.236

Japan, Indian

195

T > C

26,29,39,42, 44, 46,50

8

11/0/280/1574/0

lung-cancer cells,

thyroid tumor,

oral cancer

elderly fibroblasts, aging/AD brains,

0.042 O

Africa, Japan, American, Finland, Italy, Caucasian

199

T > C

29

1

0/0/121/1741

ovarian cancer,

POLG/MNGIE muscle

1.000

Japan, Finland, India

204

T > C

26,29

2

0/0/123/1741/0

oral cancer,

prostate tumor

0.679

Japan, Finland, India

207

G > A

26,29

2

123/1742/0/0/0

oral cancer, prostate tumor,thyroid tumor

0.679

Japan, Finland, India

242

C > T

15

1

0/0/1854/11/0

POLG/PEO muscle

0.148

Extremely rare, American, Finland

259

A > G

40

1

1866/1/0/0/0

Liver cancer

0.026 O

Extremely rare, Thaiwan

263

A > G

13,15,16,17,

18,22,25,26,

27,28,29,30,

33,34,38,39,

40,41,42,44,45,46,49,50,51

25

6/1861/0/0/0

oral cancer POLG/MNGIE muscle,

1.000

Africa, Japan, China,

Australia, American, Finland, India

285

C > T

46

1

0/0/1860/7/0

elderly fibroblasts

0.101

Extremely rare, Italy, India

295

C > T

15

1

4/0/1788/75/0

Glioblastoma,POLG/MNGIE muscle

1.000

American, Finland, India, Caucasian

303

C7 > C8 ins

16,17,26,28,29,30,38,39,40,41,42,45,51

13

-

multiple tumor types

 

Africa, Japan, Taiwan,

Finland, Italy, Spain, India, Polynesia, Caucasian,

Ashkenazi Jew, American, Australia

303

C7 > C9

Ins

18

1

-

multiple tumor types

 

Africa, Japan, Taiwan,

Finland, Italy, Spain, India, Polynesia, Caucasian,

Ashkenazi Jew, American, Australia

311

C5 > C6

Ins

13,15,16,17,

18,22,25,26,

27,28,29,30,

33,34,38,39,40,41,42,44,45,46,49,50,51

25

-

multiple tumor types

 

Africa, Japan, Taiwan,

Finland, Italy, Spain, India, Polynesia, Caucasian,

Ashkenazi Jew, American, Australia

385

A > G

46

1

1861/5/0/1/0

Twinkle/PEO frontal cortex

0.077

Extremely rare, Koraga

431

C > T

39

1

1/0/1852/14/0

ovarian cancer

0.181

Rare,Japan

462

C > T

15

1

0/0/2073/71/0

thyroid tumor

0.572

American, Finland, India, Caucasian

477

T > C

13,34

2

0/1/19/2124/0

ovarian tumor

AD brains

0.023 O

Rare, American, European

489

T > C

15

1

0/0/777/1367

ovarian carcinoma prostate tumor

0.000 U

Africa, China, Japan,

American, Finland, Italy, India

498*

C > del C

49

1

0/0/2143/1/0

 

0.023 O

Extremely rare

499

G > A

50

1

38/2106/0/0/0

thyroid tumor prostate tumors

0.366

Japan

514

CA5 > CA4

25,39,41,44, 46

5

-

ovarian carcinoma, thyroid tumors,

gastric carcinomas

-

Nd

514

CA5 > CA6

29,49,

2

-

ovarian carcinoma & control tissue,

thyroid tumors, breast tumors

-

Nd

533

A > G

16

1

2142/2/0/0/0

Polymorphism

0.034 O

Extremely rare,

Japan, Sicily

16069

C > T

15

1

0/0/1793/73/0

oral cancer

1.000

American, Caucasian,

Finland, Italy

16092

T > C

15,16,39

3

0/0/22/1845/0

oral cancer

0.004 O

Extremely rare, Japan, India

16114

C > A

45

1

8/0/1858/1/0

Polymorphism

0.113

Extremely rare, Japan, Finland

16124

T > C

29

1

0/0/9/1858

Polymorphism

0.125

Extremely rare,South Africa, Korea

16126

T > C

15,17,25,42,51

5

0/0/166/1701/0

oral cancer

0.069

China, Japan, American, Finland, Italy, India

16129

G > A

33

1

304/1554/9/0/0

oral cancer

0.164

Arica, Japan, America, Italy

16145

G > A

15

1

50/1817/0/0/0

oral cancer

0.497

Japan, American, Finland, Italy

16172

T > C

15

1

0/0/150/1717/0

head/neck tumor

back-mutation, oral cancer MNGIE tissues,

0.716

Japan, Morocco, Finland, Europe

16179

C > T

50

1

0/0/1862/5/0

Polymorphism

0.077

Asia, Austrlia

16182

A > C

22,41,42,46

4

1706/1/117/2/41

prostate tumor

0.071

China, Japan, Finland, Taiwan Aborigine, India

16183

A > C

41,42

2

1541/12/237/0/77

lung tumor back-mutation, prostate tumor

0.761

China, Japan, Finland, Taiwan Aborigine, India

16189

T > A

39

1

0/0/522/1345/0

Polymorphism

0.013 O

Extremely rare

16189

T > CC

22

1

-

endometrial tumor, familial breast

cancer

  

16189

T > C

41,45,42,46

4

0/0/522/1345/0

endometrial tumor, familial breast

caner

0.261

 

16192

C > T

16,27,29,38,

40,45

6

0/0/1854/13/0

oral cancer

0.000 O

Japan, Finland, Italy

16222

C > T

15

1

0/0/1852/15/0

oral cancer

0.192

American,

16223

C > T

26,29

2

0/0/992/875/0

oral cancer

0.000 U

Africa, Japan, China,

Australia, India, Finland,

Ashkenazi Jews

16224

T > C

33,49

2

0/0/107/1760/0

oral cancer

0.652

Japan, American, Finland,

Ashkenazi Jews

16231

T > C

51

1

0/0/11/1856/0

oral cancer

0.148

Extremely rare, Japan

16234

C > T

26

1

0/0/1800/67/0

oral cancer

0.602

China, Japan, Ashkenazi Jews

16248

C > T

51

1

0/0/1865/2/0

ovarian tumor

0.039 O

Extremely rare,

Spain, India

16249

T > C

46

1

0/0/87/1780/0

prostate tumor

1.000

Ethiopia, Japan, Italy

16256

C > T

27,38,40,45

4

0/0/1838/29/0

ovarian tumor

0.001 O

Japan, Finland, India

16261

C > T

15

1

0/0/1756/111/0

oral cancer

1.000

Japan,Taiwan Aborigine, American, India

16266

C > T

52

1

9/4/1820/34/0

oral cancer

0.375

Japan, India

16270

C > T

16,27,38,40,41,45

6

0/0/1802/65/0

oral cancer

0.000 O

Finland, Italy, India

16272

A > G

25

1

1865/2/0/0/0

Polymorphism

0.039 O

Extremely rare Taiwan Aborigine, India

16291

C > T

38

1

0/3/1816/48/0

 

0.483

Japan, Italy

16292

C > T

26,29

2

0/2/1801/64/0

breast, ovarian, head/neck tumor,

oral tumor

0.216

Japan, Finland, Italy

16293

A > G

39

1

1848/17/2/0/0

glioblastoma

0.214

Rare, Italy, India

16294

C > T

17,25,45

3

0/0/1760/107/0

-

1.000

Japan, American, Finland, Italy

16296

C > T

17,25

2

0/0/1823/44/0

head/neck tumor

0.122

American, Italy, India

16298

T > C

42

1

0/0/169/1698/0

oral cancer

prostate tumor

0.721

China, Japan, Finland, American

16300

A > G

29

1

1861/6/0/0/0

head/neck tumor

0.089

Extremely rare,

Japan

16301

C > T

39

1

0/0/1860/7/0

esophageal, breast & prostate tumors

0.101

Extremely rare Melanesia

16304

T > C

25

1

0/0/140/1727/0

esophageal, breast & prostate tumors

1.000

Japan, American, Finland, Italy

16311

T > C

33,39,49

3

0/0/340/1526/0

oral cancer

0.602

Africa, Japan, China,

American, Finland, Italy, India

16324

T > C

17

1

0/0/49/1818/0

esophageal cancer

0.490

Japan, Taiwan Aborigine

16325

T > C

29

1

0/0/47/1820/0

Polymorphism

0.476

Japan, India

16356

T > C

22,50,

2

0/0/27/1840/0

oral cancer

0.055

India, Australian, Aboriginee

16362

T > C

46

1

1/0/444/1422

oral cancer

0.016 O

India, Australian, Aboriginee

16368

T > C

49

1

0/0/15/1852/0

gastric carcinoma

0.192

Extremely rare,

Japan, Italy

16399

A > G

38,40,

2

1828/38/0/0/0

gastric carcinoma

oral cancer

0.096

Japan, Italy

16519

T > C

13,17,18,22,25,26,28,29,33,34,41,42,49,50,51

15

0/0/1115/752/0

pancreatic, cancer,oral cancer, gastric, lung, ovarian

tumor

1.000

Africa, Japan, Caucasian, China, American, Finland, Italy, India

16526

G > A

45

1

19/1848/0/0/0

Polymorphism

0.235

Finland, Onge

  

total

225

    

Unless stated otherwise, the data are from MITOMAP [63] and mtDB [42] databases.

*-previously not reported, O-overrepresented, U-underrepresented; over and under-represented polymorphisms bolded.

https://static-content.springer.com/image/art%3A10.1186%2F1423-0127-17-73/MediaObjects/12929_2010_Article_187_Fig2_HTML.jpg
Figure 2

D-loop polymorphism distribution in the studied group of VSCC patients 0 - 700 mtDNA bp (A) 16000 - 16659 bp mtDNA (B). × axis - mtDNA position (bp) - polymorphism location. Y axis - number of cases found in this study - polymorphism number.

Germ-line polymorphisms in the mtDNA coding region in VSCC cohort

The segments adjacent to the D-loop sequence (15879-803, Table 8) were also analyzed. Two polymorphisms were found within the 12 S rRNA gene, with the frequency characteristic for the world population [42].
Table 8

Polymorphisms found in the coding region of mtDNA of VSCC patients.

mtDNA position

(rCRS)

Polymorphism

Case No

No

A/G/C/T/del frequency mtDB

P-value

Region/population where sequence variant predominantly found

709

12 S rRNA

G > A

17,25,26,29,33,

41,42,46

8

444/2260/0

0.053

Africa, native Americans, Japan, American, Finland, Italy, India

750

12 S rRNA

A > G

13,15,16,17,18,22,25,26,27,28,29,30,33,34,38,39,40,41,42,44,45,46,49,50,51

25

22/2682/0/0

1.000

CRS is a rare variant; G is very common in the whole world, A/G is consensus mutation

mtDNA D-loop sequence analysis in the tumor margin

In the case of five patients (13, 38, 45, 46, 49), tumor margin samples were also available. Comparison of the D-loop sequence from the sample triplets (tumor, blood and margin) revealed no difference between these tissues in all the investigated cases, again indicating the presence of inherited polymorphisms and lack of somatic mutations.

Correlation with clinical parameters

As the polymorphisms are inherited phenomena, no correlation with TNM or clinical stage was performed. However, an interesting co-incidence of HPV infection with the specific mitochondrial haplogroup was observed. Four out of five patients with HPV infection carried haplogroup H. When taking into account only high risk HPV-16, all infected patients belonged to this haplogroup. The correlation between these two parameters was shown to be statistically significant (Table 9). This correlation is further supported by the very similar haplogroup distribution found in the head and neck tumors, that are also HPV-dependent (Figure 2C).
Table 9

HPV infection status and haplogroup co-incidence in VSCC patients.

  

HPV total

  

HPV 16

  
  

+

-

total

p-value

+

-

total

p-value

Haplogroup H

+

4

3

7

p = 0.014

3

4

7

p = 0.017

 

-

1

16

17

 

0

17

17

 
 

total

5

19

24*

 

3

21

24*

 

*- 24 patients were included in the analysis, as in one case the HPV unknown.

Discussion

Although several molecular alterations on the genomic, genetic, epigenetic and protein level have been described in VSCC, no useful molecular markers with possible clinical application have been established so far [28]. Analysis of the mitochondrial genome may provide novel cancer biomarkers for the risk assessment, diagnosis and prognosis. Mitochondrial DNA polymorphisms and/or mutations are commonly used as molecular markers in a wide range of disciplines, from human migration and population studies, to metabolic diseases, and may also prove useful in VSCC management [54]. mtDNA analysis is attractive due to its relatively low cost and lack of requirement for sophisticated technical support, thus making it accessible for most hospital laboratories [10, 55, 56].

To the best knowledge of the authors, this the first report on mtDNA status in VSCC patients. The analysis of haplogroup distribution revealed a trend toward haplogroup U and K overrepresentation, haplogroup H underrepresentation as well as super-haplogroup UK overabundance in a group of VSCC patients in comparison with a large Polish control population, VSCC. These data suggest that mitochondrial genetic background may be related to an increased risk of VSCC incidence. The inheritance of haplogroup U was previously associated with increased risk of prostate cancer and renal cancer in white North American individuals [32, 57]. Haplogroup K was also shown to increase the risk of breast cancer development among European-American women [58], whereas haplogroup U decreased the risk of this condition. The UK super-haplogroup has been hypothesized to confer less coupling efficiency of ETC, thus generating less ROS than other haplogroups (H, J and T), and would be expected rather to have a protective effect on cell damage. This hypothesis is supported by association with increased brain pH in patients with psychiatric disorders [59] and decreased risk of Parkinson disease in individuals with this haplogroup [60]. However, the functional role of genetic background conferred by UK super-haplogroup in cancer has not been investigated. To fully assess the value of the observed effect in the Polish population, a comparison of the observed haplogroup frequencies with mtDNA variant distribution in the healthy population with matched sex, age and ethnicity as well as the study on a larger patient cohort is needed [34, 61].

The second part of our study was focused on the D-loop sequence analysis in VSCC, as it has been previously found to be altered in gynecological cancers [10, 13, 15, 23, 32]. mtDNA polymorphisms characteristic for the VSCC patients were identified. Some of those polymorphisms are located in functionally important regions of the D-loop. The mitochondrial control region contains several elements essential for mtDNA replication and transcription. Sequence variants in this region may affect binding affinity of trans-acting factors, resulting in an altered rate of mitochondrial replication and transcription. Both increased and decreased mtDNA copy number have been found in several types of cancer [21]. Moreover, the polycytidine tract at nucleotide positions 303-315 was highly polymorphic in all investigated VSCC patients. This region is part of CSB II (299-315) that is essential for proper primer formation [62]. In previous studies an in vitro assay approach has shown that premature termination of transcription occurs immediately downstream to CSBII at positions 300-282, which is the site of the RNA-DNA transition point. Premature termination was abolished in 319-289 mutants, whereas mutation at nucleotide positions 304-300 showed a drastic decrease of this process [62], indicating an important role of these sequence variants in the transcription/replication switch. Moreover, the screen of human mtDNA control sequence variants revealed that the variant defining haplogroup J - C295T increased TFAM protein binding and in vitro L-strand transcription. Cybrid-based analysis of this variant demonstrated an increased copy number (2 times, J >H), but there was no difference in transcript levels. This fact provides strong support for functional importance of mtDNA control region variants, additionally underlying the role of haplogroup-defining mutations within the D-loop [29]. This variant was also found in the VC patient population. The other polymorphisms localized within mtTFAM binding sites found in the investigated cohort are G259A, C285T, C431T, A533G and mtMSI at np 514-523. These variants may possibly affect DNA-protein interactions. SNP 259A is extremely rare [42]. According to data in MITOMAP, it was also found in liver cancer, but this observation was unpublished [63].

Other highly polymorphic loci in our VSCC group of patients are at nucleotide positions 514-523. These polymorphisms are carried by seven VSCC patients. The clinical significance of 514-523 polymorphisms as biomarkers was proved in a study on breast cancer: patients with multiple alleles of (CA) polymorphism (showing heteroplasmy) had poorer survival in comparison to patients with a homoplasmic (CA) variant, thus suggesting the role of this dinucleotide repeat in cancer formation [64]. Moreover, our analysis of the D-loop sequence also revealed that three polymorphisms characteristic for haplogroup U (C16192T, C16256T and C16270T) as well asC16223C polymorphism are significantly overrepresented in the investigated group of patients. They are all located within HV1 region. 16192T is found within microsatellite (16184-16193) and was found to be a hot spot for mutations in several types of cancer [23]. This sequence variant may be important as it co-localizes with the 3' end of TAS and with the 7 S DNA binding site that are hypothesized to play a role in mtDNA synthesis [65]. Moreover, the T16189C variant was associated with an increased susceptibility to endometrial carcinoma in Chinese women [66]. The 16223C SNP was also found at a significantly higher frequency in VSCC patients compared with the normal population, which is in similar to the data obtained in our laboratory for endometrial carcinoma [11]. Furthermore, the T195C variant, overabundant in VSCC patients, was previously reported in lung [33] and thyroid cancer [67], as well as in brains of Alzheimer patients [68]. The exact role of T195C, C16223C, C16256T and C16270T is unknown. It should be noted that, as there are only a few observations for each polymorphism, the power to detect whether these SNPs play a role in VSCC incidence is relatively low and research performed on larger number of patients is needed. However, the obtained results strongly suggest a role for all these polymorphisms in conferring genetic susceptibility to VSCC development; and they appear to be attractive biomarkers of VSCC risk assessment.

In VSCC patients no somatic mutations were detected, which is in contradiction with several previous studies for other cancer types [21]. It may be claimed that blood is not a proper reference tissue, as mitochondrial mutations were also found in body fluids [33]. However, this should not be the case in the investigated cohort of patients, as none of the patients showed distant metastases, and vulvar tumor expansion occurs through the lymphatic system [69]. In addition, D-loop sequence from tumor margin also showed no alterations. Lack of somatic mutations in cancer samples is similar to previous study finding only polymorphisms in the samples of colon cancer [70]. There are also data proving the hypothesis that mtDNA polymorphisms are significantly associated with cancer development [26, 71]. Several studies report low mutation rate and an abundance of mtDNA polymorphisms in cancer samples [72]. Moreover, recent re-analyses of somatic tumor-specific alterations revealed that most of them are in fact sequence variants commonly found in the general population [7377]. Furthermore, a critical review of mtDNA mutations reported in numerous papers suggested that many of them were actually artifacts generated by methodological and technical errors, and that a lot of somatic and "novel" germline alterations seem thus to result simply from improper sample management and data analysis [78].

Another important topic of mtDNA studies in gynecological oncology is correlation of clinic-pathological characteristics with molecular markers. Due to the fact that only the germline polymorphisms were found, no correlation with TNM parameters was assessed. Interestingly, all three patients with the high risk HPV subtype 16 had haplogroup H. When analyzing all infected patients, the statistically significant overrepresentation of haplogroup H was still present. There is no literature data on any correlation between the mitochondrial haplogroup and HPV infection, but some information from research on cervical cancer is available, however, only papers focusing on the influence of HPV on mtDNA damage have been published to date. In the study of Sharma et al., a correlation between mtDNA mutations and HPV infection was found [79]. However, it cannot be concluded from the report whether the mutations were somatic or germline, as DNA sequences from tumors of patients were compared to the MITOMAP database, not to any control tissue. In another study on cervical cancer, HPV positive tumors were found to contain an increased number of somatic mutations (in comparison to precancerous stages). On the other hand, haplogroup H turned out to be highly protective against AIDS progression [80], implying that mitochondrial background might play a role in the course of virus-related diseases. The result obtained for the VSCC cohort suggests that haplotype may confer genetic susceptibility towards HPV infection. To confirm the relation of these two parameters, a study on a larger group of patients is necessary.

Our data obtained of VSCC strongly suggest the role of mtDNA polymorphisms in modifying the risk of this type of cancer incidence and opens new perspectives in search for novel VSCC molecular markers. Therefore, it seems plausible that mtDNA analysis (possibly combined with other molecular markers) may help to identify individuals at risk of developing VSCC. The mitochondrial genetic background is also likely to play a role in predisposition to HPV infection, creating a hope for the establishment of a novel molecular diagnostic tool. However, to fully evaluate the prognostic potential of the discovered alterations, investigation of a more representative patient group is necessary. Such research should include, in addition to the information on mtDNA status, also data about other molecular alterations found within the tumor, thus allowing a broader perspective for an assessment of the role of mtDNA in tumorigenesis. It should be noted that our study includes only the data obtained from the sequencing of the D-loop region. In order to obtain a complete picture of a potential role of mtDNA in the formation and expansion of this cancer, it would be necessary to perform whole mitochondrial genome sequencing, including other cancer-related tissues (from recurrences, distant metastases or margin). Such experiments should also allow to further estimate the prognostic value of data based on the D-loop sequence itself, and possibly reveal some other potential risk factors, as it was the case for G10398A in breast cancer among African American-women [81]. Moreover, as the data were compared with general mitochondrial databases [42, 63], the idea of comparison with the mtDNA sequences (D-loop and coding region) from healthy Polish subjects would also be valuable. Although acquiring a representative set of such data is labour-intensive, in further perspective it seems to be worth the effort.

Conclusions

Mitochondrial research may enable establishment of bio-markers allowing the identification of individuals at high risk for vulvar cancer and to develop screening approaches and early diagnosis tools. Moreover, analysis of mtDNA polymorphism (and possibly also mutational) pattern may be used to select population at increased risk of cancer development, who should be enrolled in extensive screening program. Molecular assessment of mitochondrial abnormalities of cancer cells could represent a promising tool not only for prognosis and early diagnosis of neoplasia, but possibly also during the follow-up of cancer patients. If cost-effectiveness of molecular techniques is considered. PCR seems to be the optimal method for outpatient treatment regimens. Additionally, the application of PCR-coupled with gel electrophoresis or DNA sequencing may be used for rapid analysis of multiple samples in hospital laboratories. In the clinical context, the high frequency of mitochondrial genome instability, in combination with PCR-based assays of high sensitivity, may be of potential usefulness. In future studies related to cancer epidemiology, the significance of a particular mtDNA polymorphism(s) should be analyzed together with other polymorphisms in mtDNA and in nuclear DNA.

Declarations

Acknowledgements

This work was supported by the Medical University of Warsaw, Polish Mitochondrial Network MitoNet.pl, Ministry of Science and Higher Education of The Republic of Poland Grant No. N N401 2327 33 to EB and AMC; Oligo.pl Minigrant G11 to EB, PG, AMC and KP, Polish Genetics Society Grant 2006/07 to EB, AMC, KP, and AlK. AMC was supported by FEBS Collaborative Experimental Scholarship for Central & Eastern Europe, Fulbright Junior Research Grant and The Kosciuszko Foundation Scholarship.

The project realization by its authors wouldn't have been possible without the support of Prof. Piotr Weglenski (Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw). The authors would like to thank Jerzy S. Czarnecki, PhD (University of Lodz, Lodz, Poland) and Przemyslaw Tomalski, PhD (University of East London, London, UK) for critical reading of the manuscript and fruitful discussions.

Authors’ Affiliations

(1)
Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw
(2)
Laboratory of Molecular Oncology, Department of Oncology, Military Institute of the Health Services
(3)
Maria Skłodowska-Curie Memorial Cancer Centre and Institute of Oncology, Department of Molecular Biology
(4)
Department of Otolaryngology, Czerniakowski Hospital, Medical University of Warsaw
(5)
International Institute of Molecular and Cell Biology in Warsaw
(6)
Institute of Biochemistry and Biophysics, Polish Academy of Sciences
(7)
Maria Sklodowska-Curie Memorial Cancer Centre and Institute of Oncology, Department of Brachytherapy

References

  1. Polish Cancer Registry. 2009, [http://epid.coi.waw.pl/krn]
  2. Knopp S, Trope C, Nesland JM, Holm R: A review of molecular pathological markers in vulvar carcinoma: lack of application in clinical practice. J Clin Pathol. 2009, 62 (3): 212-218. 10.1136/jcp.2008.057240.View ArticlePubMed
  3. Kowalewska M, Szkoda MT, Radziszewski J, Ptaszynski K, Bidzinski M, Siedlecki JA: The frequency of human papillomavirus infection in polish patients with vulvar squamous cell carcinoma. Int J Gynecol Cancer. 2009, 20 (3): 434-437. 10.1111/IGC.0b013e3181d320f1.View Article
  4. Wallace DC, Fan W, Procaccio V: Mitochondrial energetics and therapeutics. Annu Rev Pathol. 5: 297-348. 10.1146/annurev.pathol.4.110807.092314.
  5. Dimauro S, Davidzon G: Mitochondrial DNA and disease. Ann Med. 2005, 37 (3): 222-232. 10.1080/07853890510007368.View ArticlePubMed
  6. Mancuso M, Filosto M, Choub A, Tentorio M, Broglio L, Padovani A, Siciliano G: Mitochondrial DNA-related disorders. Bioscience reports. 2007, 27 (1-3): 31-37. 10.1007/s10540-007-9035-2.View ArticlePubMed
  7. Wallace DC: Mitochondrial DNA mutations in disease and aging. Environ Mol Mutagen. 2010, 51 (5): 440-450.PubMed
  8. Warburg O: On the Origin of Cancer Cells. Science. 1956, 123 (1): 309-314. 10.1126/science.123.3191.309.View ArticlePubMed
  9. Brandon M, Baldi P, Wallace DC: Mitochondrial mutations in cancer. Oncogene. 2006, 25 (34): 4647-4662. 10.1038/sj.onc.1209607.View ArticlePubMed
  10. Czarnecka AM, Bartnik E: Mitochondrial DNA Mutations in Tumors. Cellular Respiration and Carcinogenesis. Edited by: Apte SP, Sarangarajan R. 2009, New York City: Humana Press, 1-12. full_text.
  11. Czarnecka AM, Klemba A, Semczuk A, Plak K, Marzec B, Krawczyk T, Kofler B, Golik P, Bartnik E: Common mitochondrial polymorphisms as risk factor for endometrial cancer. Int Arch Med. 2009, 2 (1): 33-10.1186/1755-7682-2-33.PubMed CentralView ArticlePubMed
  12. Czarnecka AM, Krawczyk T, Zdrozny M, Lubinski J, Arnold RS, Kukwa W, Scinska A, Golik P, Bartnik E, Petros JA: Mitochondrial NADH-dehydrogenase subunit 3 (ND3) polymorphism (A10398G) and sporadic breast cancer in Poland. Breast Cancer Res Treat. 2009
  13. Czarnecka A, Golik P, Bartnik E: Mitochondrial DNA mutations in human neoplasia. J Appl Genet. 2006, 47 (1): 67-78. 10.1007/BF03194602.View ArticlePubMed
  14. Czarnecka AM, Krawczyk T, Czarnecki JS, Kukwa W, Ścińska A, Ribbene A, Lo Verde R, Sunseri A, Peri G: Methodology For Mitochondrial DNA Research In Oncology: Goals And Pitfalls. ARS Medica Tomitana. 2008, XIV (1(52)): 48-64.
  15. Czarnecka AM, Marino Gammazza A, Di Felice V, Zummo G, Cappello F: Cancer as a "Mitochondriopathy". J Cancer Mol. 2007, 3 (3): 71-79.
  16. Wallace DC: A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet. 2005, 39: 359-407. 10.1146/annurev.genet.39.110304.095751.PubMed CentralView ArticlePubMed
  17. Czarnecka AM, Kukwa W, Krawczyk T, Scinska A, Kukwa A, Cappello F: Mitochondrial DNA mutations in cancer - from bench to bedside. Front Biosci. 2010, 15: 437-460. 10.2741/3629.View Article
  18. Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Imanishi H, Nakada K, Honma Y, Hayashi J: ROS-generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science. 2008, 320 (5876): 661-664. 10.1126/science.1156906.View ArticlePubMed
  19. Arnold RS, Sun CQ, Richards JC, Grigoriev G, Coleman IM, Nelson PS, Hsieh CL, Lee JK, Xu Z, Rogatko A, Osunkoya AO, Zayzafoon M, Chung L, Petros JA: Mitochondrial DNA mutation stimulates prostate cancer growth in bone stromal environment. Prostate. 2009, 69 (1): 1-11. 10.1002/pros.20854.PubMed CentralView ArticlePubMed
  20. Petros JA, Baumann AK, Ruiz-Pesini E, Amin MB, Sun CQ, Hall J, Lim S, Issa MM, Flanders WD, Hosseini SH, Marshall FF, Wallace DC: mtDNA mutations increase tumorigenicity in prostate cancer. Proc Natl Acad Sci USA. 2005, 102 (3): 719-724. 10.1073/pnas.0408894102.PubMed CentralView ArticlePubMed
  21. Lee HC, Wei YH: Mitochondrial DNA instability and metabolic shift in human cancers. Int J Mol Sci. 2009, 10 (2): 674-701. 10.3390/ijms10020674.PubMed CentralView ArticlePubMed
  22. Chatterjee A, Mambo E, Sidransky D: Mitochondrial DNA mutations in human cancer. Oncogene. 2006, 25 (34): 4663-4674. 10.1038/sj.onc.1209604.View ArticlePubMed
  23. Wang Y, Liu VW, Tsang PC, Chiu PM, Cheung AN, Khoo US, Nagley P, Ngan HY: Microsatellite instability in mitochondrial genome of common female cancers. Int J Gynecol Cancer. 2006, 16 (Suppl 1): 259-266. 10.1111/j.1525-1438.2006.00412.x.View ArticlePubMed
  24. Wang Y, Xue WC, Liu VW, Ngan HY: Detection of mosaic pattern of mitochondrial DNA alterations in different populations of cells from the same endometrial tumor. Mitochondrion. 2007, 7 (1-2): 171-175. 10.1016/j.mito.2006.11.014.View ArticlePubMed
  25. Liu VW, Yang HJ, Wang Y, Tsang PC, Cheung AN, Chiu PM, Ng TY, Wong LC, Nagley P, Ngan HY: High frequency of mitochondrial genome instability in human endometrial carcinomas. Br J Cancer. 2003, 89 (4): 697-701. 10.1038/sj.bjc.6601110.PubMed CentralView ArticlePubMed
  26. Xu L, Hu Y, Chen B, Tang W, Han X, Yu H, Xiao C: Mitochondrial polymorphisms as risk factors for endometrial cancer in southwest China. Int J Gynecol Cancer. 2006, 16 (4): 1661-1667. 10.1111/j.1525-1438.2006.00641.x.View ArticlePubMed
  27. Liu VW, Shi HH, Cheung AN, Chiu PM, Leung TW, Nagley P, Wong LC, Ngan HY: High incidence of somatic mitochondrial DNA mutations in human ovarian carcinomas. Cancer Res. 2001, 61 (16): 5998-6001.PubMed
  28. Bragoszewski P, Kupryjanczyk J, Bartnik E, Rachinger A, Ostrowski J: Limited clinical relevance of mitochondrial DNA mutation and gene expression analyses in ovarian cancer. BMC Cancer. 2008, 8: 292-10.1186/1471-2407-8-292.PubMed CentralView ArticlePubMed
  29. Suissa S, Wang Z, Poole J, Wittkopp S, Feder J, Shutt TE, Wallace DC, Shadel GS, Mishmar D: Ancient mtDNA genetic variants modulate mtDNA transcription and replication. PLoS Genet. 2009, 5 (5): e1000474-10.1371/journal.pgen.1000474.PubMed CentralView ArticlePubMed
  30. Wallace DC: Mitochondria as chi. Genetics. 2008, 179 (2): 727-735. 10.1534/genetics.104.91769.PubMed CentralView ArticlePubMed
  31. Jakupciak JP, Dakubo GD, Maragh S, Parr RL: Analysis of potential cancer biomarkers in mitochondrial DNA. Curr Opin Mol Ther. 2006, 8 (6): 500-506.PubMed
  32. Czarnecka AM, Kukwa W, Krawczyk T, Scinska A, Kukwa A, Cappello F: Mitochondrial DNA mutations in cancer--from bench to bedside. Front Biosci. 2010, 15: 437-460. 10.2741/3629.View Article
  33. Fliss MS, Usadel H, Caballero OL, Wu L, Buta MR, Eleff SM, Jen J, Sidransky D: Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Science. 2000, 287 (5460): 2017-2019. 10.1126/science.287.5460.2017.View ArticlePubMed
  34. Czarnecka AM, Krawczyk T, Czarnecki JS, Kukwa W, Ścińska A, Ribbene A, Lo Verde R, Sunseri A, Peri G: Methodology For Mitochondrial DNA Research In Oncology: Goals And Pitfalls. ARS Medica Tomitana. 2008, XIV (1(52)): 48-64.
  35. Kowalewska M, Radziszewski J, Kulik J, Barathova M, Nasierowska-Guttmajer A, Bidzinski M, Pastorek J, Pastorekova S, Siedlecki JA: Detection of carbonic anhydrase 9-expressing tumor cells in the lymph nodes of vulvar carcinoma patients by RT-PCR. Int J Cancer. 2005, 116 (6): 957-962. 10.1002/ijc.21106.View ArticlePubMed
  36. Kowalewska M, Szkoda MT, Radziszewski J, Ptaszynski K, Bidzinski M, Siedlecki JA: The frequency of human papillomavirus infection in Polish patients with vulvar squamous carcinoma. Int J Gynecol Cancer. 2010, 20: 434-437. 10.1111/IGC.0b013e3181d320f1.View ArticlePubMed
  37. Mossakowska M, Barcikowska M, Broczek K, Grodzicki T, Klich-Raczka A, Kupisz-Urbanska M, Podsiadly-Marczykowska T, Sikora E, Szybinska A, Wieczorowska-Tobis K, Zyczkowska J, Kuznicki J: Polish Centenarians Programme. Multidisciplinary studies of successful ageing: aims, methods, and preliminary results. Exp Gerontol. 2008, 43 (3): 238-244. 10.1016/j.exger.2007.10.014.View ArticlePubMed
  38. Piechota J, Tonska K, Nowak M, Kabzinska D, Lorenc A, Bartnik E: Comparison between the Polish population and European populations on the basis of mitochondrial morphs and haplogroups. Acta Biochim Pol. 2004, 51 (4): 883-895.PubMed
  39. Malyarchuk BA, Grzybowski T, Derenko MV, Czarny J, Wozniak M, Miscicka-Sliwka D: Mitochondrial DNA variability in Poles and Russians. Annals of human genetics. 2002, 66 (Pt 4): 261-283. 10.1046/j.1469-1809.2002.00116.x.View ArticlePubMed
  40. Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N: Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 1999, 23 (2): 147-10.1038/13779.View ArticlePubMed
  41. Ruiz-Pesini E, Lott MT, Procaccio V, Poole JC, Brandon MC, Mishmar D, Yi C, Kreuziger J, Baldi P, Wallace DC: An enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic Acids Res. 2007, D823-828. 10.1093/nar/gkl927. 35 Database
  42. Ingman M, Gyllensten U: mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res. 2006, D749-751. 10.1093/nar/gkj010. 34 Database
  43. Czarnecka AM, Krawczyk T, Plak K, Klemba A, Zdrozny M, Arnold RS, Kofler B, Golik P, Szybinska A, Lubinski J: Mitochondrial Genotype and Breast Cancer Predisposition. Oncol Rep. 2010,
  44. Torroni A, Huoponen K, Francalacci P, Petrozzi M, Morelli L, Scozzari R, Obinu D, Savontaus ML, Wallace DC: Classification of European mtDNAs from an analysis of three European populations. Genetics. 1996, 144 (4): 1835-1850.PubMed CentralPubMed
  45. Herrnstadt C, Elson JL, Fahy E, Preston G, Turnbull DM, Anderson C, Ghosh SS, Olefsky JM, Beal MF, Davis RE, Howell N: Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups. Am J Hum Genet. 2002, 70 (5): 1152-1171. 10.1086/339933.PubMed CentralView ArticlePubMed
  46. Bandelt HJ, Lahermo P, Richards M, Macaulay V: Detecting errors in mtDNA data by phylogenetic analysis. International journal of legal medicine. 2001, 115 (2): 64-69. 10.1007/s004140100228.View ArticlePubMed
  47. Sheskin DJ: Handbook of parametric and nonparametric statistical procedures. 2007, Boca Raton, FL: Chapman & Hall, 4
  48. Campbell I: Chi-squared and Fisher-Irwin tests of two-by-two tables with small sample recommendations. Stat Med. 2007, 26 (19): 3661-3675. 10.1002/sim.2832.View ArticlePubMed
  49. Fleiss JL, Levin B, Cho Paik M, Fleiss J: Statistical Methods for Rates & Proportions. 2003, San Francisco, CA: Wiley-Interscience Inc, 3View Article
  50. Rosner B: Fundamentals of Biostatistics. 2005, Florence, KY: Duxbury Press, 6
  51. Derenko MV, Grzybowski T, Malyarchuk BA, Dambueva IK, Denisova GA, Czarny J, Dorzhu CM, Kakpakov VT, Miścicka-Sliwka D, Woźniak M, Zakharov IA: Diversity of mitochondrial DNA lineages in South Siberia. Annals of human genetics. 2003, 67 (Pt 5): 391-411. 10.1046/j.1469-1809.2003.00035.x.View ArticlePubMed
  52. Finnila S, Lehtonen MS, Majamaa K: Phylogenetic network for European mtDNA. Am J Hum Genet. 2001, 68 (6): 1475-1484. 10.1086/320591.PubMed CentralView ArticlePubMed
  53. Czarnecka A, Klemba A, Semczuk A, Plak K, Marzec B, Krawczyk T, Kofler B, Golik P, Bartnik E: Common mitochondrial polymorphisms as risk factor for endometrial cancer. 2009
  54. Wallace DC: A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet. 2005, 39: 359-407. 10.1146/annurev.genet.39.110304.095751.PubMed CentralView ArticlePubMed
  55. Czarnecka AM, Campanella C, Zummo G, Cappello F: Mitochondrial chaperones in cancer: from molecular biology to clinical diagnostics. Cancer Biol Ther. 2006, 5 (7): 714-720.View ArticlePubMed
  56. Czarnecka AM, Campanella C, Zummo G, Cappello F: Mitochondrial chaperones in cancer: from molecular biology to clinical diagnostics. Cancer Biol Ther. 2006, 5 (7): 714-720.View ArticlePubMed
  57. Booker LM, Habermacher GM, Jessie BC, Sun QC, Baumann AK, Amin M, Lim SD, Fernandez-Golarz C, Lyles RH, Brown MD, Marshall FF, Petros JA: North American white mitochondrial haplogroups in prostate and renal cancer. The Journal of urology. 2006, 175 (2): 468-472. 10.1016/S0022-5347(05)00163-1. discussion 472-463View ArticlePubMed
  58. Bai RK, Leal SM, Covarrubias D, Liu A, Wong LJ: Mitochondrial genetic background modifies breast cancer risk. Cancer Res. 2007, 67 (10): 4687-4694. 10.1158/0008-5472.CAN-06-3554.View ArticlePubMed
  59. Rollins B, Martin MV, Sequeira PA, Moon EA, Morgan LZ, Watson SJ, Schatzberg A, Akil H, Myers RM, Jones EG, Wallace DC, Bunney WE, Vawter MP: Mitochondrial variants in schizophrenia, bipolar disorder, and major depressive disorder. PloS one. 2009, 4 (3): e4913-10.1371/journal.pone.0004913.PubMed CentralView ArticlePubMed
  60. Gaweda-Walerych K, Maruszak A, Safranow K, Bialecka M, Klodowska-Duda G, Czyzewski K, Slawek J, Rudzinska M, Styczynska M, Opala G, Drozdzik M, Canter JA, Barcikowska M, Zekanowski C: Mitochondrial DNA haplogroups and subhaplogroups are associated with Parkinson's disease risk in a Polish PD cohort. J Neural Transm. 2008, 115 (11): 1521-1526. 10.1007/s00702-008-0121-9.View ArticlePubMed
  61. Salas A, Carracedo A, Macaulay V, Richards M, Bandelt HJ: A practical guide to mitochondrial DNA error prevention in clinical, forensic, and population genetics. Biochem Biophys Res Commun. 2005, 335 (3): 891-899. 10.1016/j.bbrc.2005.07.161.View ArticlePubMed
  62. Pham XH, Farge G, Shi Y, Gaspari M, Gustafsson CM, Falkenberg M: Conserved sequence box II directs transcription termination and primer formation in mitochondria. J Biol Chem. 2006, 281 (34): 24647-24652. 10.1074/jbc.M602429200.View ArticlePubMed
  63. MITOMAP: A human Mitochondrial Genome Database. [http://www.mitomap.org]
  64. Ye C, Gao YT, Wen W, Breyer JP, Shu XO, Smith JR, Zheng W, Cai Q: Association of mitochondrial DNA displacement loop (CA)n dinucleotide repeat polymorphism with breast cancer risk and survival among Chinese women. Cancer Epidemiol Biomarkers Prev. 2008, 17 (8): 2117-2122. 10.1158/1055-9965.EPI-07-2798.PubMed CentralView ArticlePubMed
  65. Fernandez-Silva P, Enriquez JA, Montoya J: Replication and transcription of mammalian mitochondrial DNA. Exp Physiol. 2003, 88 (1): 41-56. 10.1113/eph8802514.View ArticlePubMed
  66. Liu VW, Wang Y, Yang HJ, Tsang PC, Ng TY, Wong LC, Nagley P, Ngan HY: Mitochondrial DNA variant 16189T > C is associated with susceptibility to endometrial cancer. Hum Mutat. 2003, 22 (2): 173-174. 10.1002/humu.10244.View ArticlePubMed
  67. Maximo V, Soares P, Lima J, Cameselle-Teijeiro J, Sobrinho-Simoes M: Mitochondrial DNA somatic mutations (point mutations and large deletions) and mitochondrial DNA variants in human thyroid pathology: a study with emphasis on Hurthle cell tumors. Am J Pathol. 2002, 160 (5): 1857-1865.PubMed CentralView ArticlePubMed
  68. Coskun PE, Beal MF, Wallace DC: Alzheimer's brains harbor somatic mtDNA control-region mutations that suppress mitochondrial transcription and replication. Proc Natl Acad Sci USA. 2004, 101 (29): 10726-10731. 10.1073/pnas.0403649101.PubMed CentralView ArticlePubMed
  69. Bręborowicz G: Położnictwo i ginekologia Warszawa. 2008
  70. Heerdt BG, Chen J, Stewart LR, Augenlicht LH: Polymorphisms, but lack of mutations or instability, in the promotor region of the mitochondrial genome in human colonic tumors. Cancer research. 1994, 54 (14): 3912-3915.PubMed
  71. Datta S, Majumder M, Biswas NK, Sikdar N, Roy B: Increased risk of oral cancer in relation to common Indian mitochondrial polymorphisms and Autosomal GSTP1 locus. Cancer. 2007, 110 (9): 1991-1999. 10.1002/cncr.23016.View ArticlePubMed
  72. Gomez-Zaera M, Abril J, Gonzalez L, Aguilo F, Condom E, Nadal M, Nunes V: Identification of somatic and germline mitochondrial DNA sequence variants in prostate cancer patients. Mutat Res. 2006, 595 (1-2): 42-51.View ArticlePubMed
  73. Brandon M, Baldi P, Wallace DC: Mitochondrial mutations in cancer. Oncogene. 2006, 25 (34): 4647-4662. 10.1038/sj.onc.1209607.View ArticlePubMed
  74. Bandelt HJ: Mosaics of ancient mitochondrial DNA: positive indicators of nonauthenticity. Eur J Hum Genet. 2005, 13 (10): 1106-1112. 10.1038/sj.ejhg.5201476.View ArticlePubMed
  75. Bandelt HJ, Achilli A, Kong QP, Salas A, Lutz-Bonengel S, Sun C, Zhang YP, Torroni A, Yao YG: Low "penetrance" of phylogenetic knowledge in mitochondrial disease studies. Biochem Biophys Res Commun. 2005, 333 (1): 122-130. 10.1016/j.bbrc.2005.04.055.View ArticlePubMed
  76. Bandelt HJ, Quintana-Murci L, Salas A, Macaulay V: The fingerprint of phantom mutations in mitochondrial DNA data. Am J Hum Genet. 2002, 71 (5): 1150-1160. 10.1086/344397.PubMed CentralView ArticlePubMed
  77. Bandelt HJ, Yao YG, Bravi CM, Salas A, Kivisild T: Median network analysis of defectively sequenced entire mitochondrial genomes from early and contemporary disease studies. J Hum Genet. 2009, 54 (3): 174-181. 10.1038/jhg.2009.9.View ArticlePubMed
  78. Salas A, Yao YG, Macaulay V, Vega A, Carracedo A, Bandelt HJ: A critical reassessment of the role of mitochondria in tumorigenesis. PLoS Med. 2005, 2 (11): e296-10.1371/journal.pmed.0020296.PubMed CentralView ArticlePubMed
  79. Sharma H, Singh A, Sharma C, Jain SK, Singh N: Mutations in the mitochondrial DNA D-loop region are frequent in cervical cancer. Cancer cell international. 2005, 5: 34-10.1186/1475-2867-5-34.PubMed CentralView ArticlePubMed
  80. Hendrickson SL, Hutcheson HB, Ruiz-Pesini E, Poole JC, Lautenberger J, Sezgin E, Kingsley L, Goedert JJ, Vlahov D, Donfield S, Wallace DC, O'Brien SJ: Mitochondrial DNA haplogroups influence AIDS progression. AIDS. 2008, 22 (18): 2429-2439. 10.1097/QAD.0b013e32831940bb.PubMed CentralView ArticlePubMed
  81. Canter JA, Kallianpur AR, Parl FF, Millikan RC: Mitochondrial DNA G10398A polymorphism and invasive breast cancer in African-American women. Cancer research. 2005, 65 (17): 8028-8033.PubMed

Copyright

© Klemba et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.